Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635276_at:

>probe:Drosophila_2:1635276_at:308:611; Interrogation_Position=410; Antisense; TGACTAAGCACTCGACGGGCCGACT
>probe:Drosophila_2:1635276_at:197:131; Interrogation_Position=527; Antisense; ACCTCGAGGACTTCAGTTGCACGGA
>probe:Drosophila_2:1635276_at:161:135; Interrogation_Position=626; Antisense; ACGCCATGGGCTTTCTGATTTTTTA
>probe:Drosophila_2:1635276_at:148:701; Interrogation_Position=648; Antisense; TTATTCCCAGGCCAGATTGTTTGCT
>probe:Drosophila_2:1635276_at:332:5; Interrogation_Position=663; Antisense; ATTGTTTGCTCCCTGGCTGCGATTA
>probe:Drosophila_2:1635276_at:8:197; Interrogation_Position=704; Antisense; AACTGGCTTGTTGCTCTCTGGCCTT
>probe:Drosophila_2:1635276_at:640:589; Interrogation_Position=731; Antisense; TGGTTTGCTGGGAGCGCATCTCTAC
>probe:Drosophila_2:1635276_at:718:517; Interrogation_Position=804; Antisense; GTGGATGGCCTTCTTTGCAACAGTA
>probe:Drosophila_2:1635276_at:166:725; Interrogation_Position=818; Antisense; TTGCAACAGTATTTGTGGCCCACCT
>probe:Drosophila_2:1635276_at:527:79; Interrogation_Position=851; Antisense; AGGTGCGAGTAAAACGCCGTCCCAT
>probe:Drosophila_2:1635276_at:689:133; Interrogation_Position=864; Antisense; ACGCCGTCCCATGCCAAGAAATGAA
>probe:Drosophila_2:1635276_at:718:231; Interrogation_Position=883; Antisense; AATGAACAGATCTACGGCTACGCGG
>probe:Drosophila_2:1635276_at:676:559; Interrogation_Position=898; Antisense; GGCTACGCGGGATACTACACCAGAG
>probe:Drosophila_2:1635276_at:273:279; Interrogation_Position=927; Antisense; CTACGGCTACTGACATTCGATGTGT

Paste this into a BLAST search page for me
TGACTAAGCACTCGACGGGCCGACTACCTCGAGGACTTCAGTTGCACGGAACGCCATGGGCTTTCTGATTTTTTATTATTCCCAGGCCAGATTGTTTGCTATTGTTTGCTCCCTGGCTGCGATTAAACTGGCTTGTTGCTCTCTGGCCTTTGGTTTGCTGGGAGCGCATCTCTACGTGGATGGCCTTCTTTGCAACAGTATTGCAACAGTATTTGTGGCCCACCTAGGTGCGAGTAAAACGCCGTCCCATACGCCGTCCCATGCCAAGAAATGAAAATGAACAGATCTACGGCTACGCGGGGCTACGCGGGATACTACACCAGAGCTACGGCTACTGACATTCGATGTGT

Full Affymetrix probeset data:

Annotations for 1635276_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime