Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635278_at:

>probe:Drosophila_2:1635278_at:267:645; Interrogation_Position=1555; Antisense; TCATTTACGATAAACCCGACGCCAG
>probe:Drosophila_2:1635278_at:541:303; Interrogation_Position=1570; Antisense; CCGACGCCAGAGACCCAGAATTTAT
>probe:Drosophila_2:1635278_at:674:85; Interrogation_Position=1634; Antisense; AGTGAAGCCGGCGATCTTTGATCTC
>probe:Drosophila_2:1635278_at:111:693; Interrogation_Position=1650; Antisense; TTTGATCTCTTCCTGACTTTCGTCA
>probe:Drosophila_2:1635278_at:167:275; Interrogation_Position=1673; Antisense; CATTGGCGCCTATCTATTGGCTGTA
>probe:Drosophila_2:1635278_at:560:3; Interrogation_Position=1688; Antisense; ATTGGCTGTATTCCTGGCCATACAA
>probe:Drosophila_2:1635278_at:340:539; Interrogation_Position=1723; Antisense; GGTTTTACGATGAAGTTTCCAAGCT
>probe:Drosophila_2:1635278_at:636:659; Interrogation_Position=1747; Antisense; TAACGAAGGAGGATCCCGCGGGTCA
>probe:Drosophila_2:1635278_at:56:545; Interrogation_Position=1757; Antisense; GGATCCCGCGGGTCAATCCAATGGA
>probe:Drosophila_2:1635278_at:328:235; Interrogation_Position=1771; Antisense; AATCCAATGGACACTCTTCTGAACG
>probe:Drosophila_2:1635278_at:502:601; Interrogation_Position=1935; Antisense; TGTAGAAATCTGTCCACGTCCATGT
>probe:Drosophila_2:1635278_at:119:505; Interrogation_Position=1952; Antisense; GTCCATGTCCATGTGGCTATCGAAA
>probe:Drosophila_2:1635278_at:678:569; Interrogation_Position=1966; Antisense; GGCTATCGAAATTGACTCCTTTTGT
>probe:Drosophila_2:1635278_at:602:167; Interrogation_Position=2000; Antisense; AAATGGCTCCGATTATCATAAGTAC

Paste this into a BLAST search page for me
TCATTTACGATAAACCCGACGCCAGCCGACGCCAGAGACCCAGAATTTATAGTGAAGCCGGCGATCTTTGATCTCTTTGATCTCTTCCTGACTTTCGTCACATTGGCGCCTATCTATTGGCTGTAATTGGCTGTATTCCTGGCCATACAAGGTTTTACGATGAAGTTTCCAAGCTTAACGAAGGAGGATCCCGCGGGTCAGGATCCCGCGGGTCAATCCAATGGAAATCCAATGGACACTCTTCTGAACGTGTAGAAATCTGTCCACGTCCATGTGTCCATGTCCATGTGGCTATCGAAAGGCTATCGAAATTGACTCCTTTTGTAAATGGCTCCGATTATCATAAGTAC

Full Affymetrix probeset data:

Annotations for 1635278_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime