FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635279_at:

>probe:Drosophila_2:1635279_at:79:633; Interrogation_Position=1128; Antisense; TCCCGGAGTTCTCTTCATCGATGAA
>probe:Drosophila_2:1635279_at:498:341; Interrogation_Position=1161; Antisense; GCTTGATTTGGAGACCTTCACCTAC
>probe:Drosophila_2:1635279_at:209:367; Interrogation_Position=1201; Antisense; GAATCTCCCATTGCACCAATTGTGA
>probe:Drosophila_2:1635279_at:397:461; Interrogation_Position=1224; Antisense; GATTTTTGCCACCAATCGTGGACGC
>probe:Drosophila_2:1635279_at:609:555; Interrogation_Position=1243; Antisense; GGACGCTGTGTTATTCGTGGCACCA
>probe:Drosophila_2:1635279_at:300:141; Interrogation_Position=1286; Antisense; ACGGAATTCCGCTAGATCTGCTCGA
>probe:Drosophila_2:1635279_at:256:677; Interrogation_Position=1298; Antisense; TAGATCTGCTCGATCGTTTGCTGAT
>probe:Drosophila_2:1635279_at:277:97; Interrogation_Position=1361; Antisense; AGATAATCAAGTTGCGCGCCCAGAC
>probe:Drosophila_2:1635279_at:664:381; Interrogation_Position=1407; Antisense; GAACGCATTTACACGTCTCAGCGAG
>probe:Drosophila_2:1635279_at:170:611; Interrogation_Position=1472; Antisense; TGACCCCGGCTCATCAGATGTGCAA
>probe:Drosophila_2:1635279_at:714:509; Interrogation_Position=1498; Antisense; GTGAACGGACGCAACCAGATCAGCA
>probe:Drosophila_2:1635279_at:652:23; Interrogation_Position=1529; Antisense; ATATCGAGGATGTGCACTCGCTCTT
>probe:Drosophila_2:1635279_at:483:321; Interrogation_Position=1566; Antisense; GCGCTCCTCGAAGCATTTGTCCGAA
>probe:Drosophila_2:1635279_at:144:7; Interrogation_Position=1640; Antisense; ATTCCATTTGCACGGATTTCCCAGT

Paste this into a BLAST search page for me
TCCCGGAGTTCTCTTCATCGATGAAGCTTGATTTGGAGACCTTCACCTACGAATCTCCCATTGCACCAATTGTGAGATTTTTGCCACCAATCGTGGACGCGGACGCTGTGTTATTCGTGGCACCAACGGAATTCCGCTAGATCTGCTCGATAGATCTGCTCGATCGTTTGCTGATAGATAATCAAGTTGCGCGCCCAGACGAACGCATTTACACGTCTCAGCGAGTGACCCCGGCTCATCAGATGTGCAAGTGAACGGACGCAACCAGATCAGCAATATCGAGGATGTGCACTCGCTCTTGCGCTCCTCGAAGCATTTGTCCGAAATTCCATTTGCACGGATTTCCCAGT

Full Affymetrix probeset data:

Annotations for 1635279_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720