FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635280_at:

>probe:Drosophila_2:1635280_at:19:71; Interrogation_Position=1346; Antisense; AGGCGAACATTATTCTGGGCGGACA
>probe:Drosophila_2:1635280_at:294:397; Interrogation_Position=1381; Antisense; GACAAGGGATCCCTTTTCTACGCAC
>probe:Drosophila_2:1635280_at:44:673; Interrogation_Position=1399; Antisense; TACGCACCCACAATTGTCACAGATG
>probe:Drosophila_2:1635280_at:383:641; Interrogation_Position=1432; Antisense; TCGGCGCAACTCTACTCGGAGGAGG
>probe:Drosophila_2:1635280_at:109:435; Interrogation_Position=1453; Antisense; GAGGTCTTTGGTCCAGTGGTCTCCA
>probe:Drosophila_2:1635280_at:426:83; Interrogation_Position=1467; Antisense; AGTGGTCTCCATCATACGGTTCCGA
>probe:Drosophila_2:1635280_at:211:581; Interrogation_Position=1538; Antisense; TGGCCGGTTACTTCTACAGCGAGAA
>probe:Drosophila_2:1635280_at:374:65; Interrogation_Position=1606; Antisense; ATGGTCGGCGTCAACGAAGGCATCA
>probe:Drosophila_2:1635280_at:719:369; Interrogation_Position=1621; Antisense; GAAGGCATCATCTCCGCAGCAGAGG
>probe:Drosophila_2:1635280_at:499:265; Interrogation_Position=1640; Antisense; CAGAGGCTCCGTTTGGTGGCGTCAA
>probe:Drosophila_2:1635280_at:101:433; Interrogation_Position=1684; Antisense; GAGGGTTCCAAACACGGTATCGACG
>probe:Drosophila_2:1635280_at:513:347; Interrogation_Position=1733; Antisense; GCATGGGCAACCTCAAGTACGACTG
>probe:Drosophila_2:1635280_at:85:615; Interrogation_Position=1756; Antisense; TGAAGTCCGATGGAGGGATCACCCC
>probe:Drosophila_2:1635280_at:605:695; Interrogation_Position=1787; Antisense; TTTCATACGCTGTCTTCCACTAGAA

Paste this into a BLAST search page for me
AGGCGAACATTATTCTGGGCGGACAGACAAGGGATCCCTTTTCTACGCACTACGCACCCACAATTGTCACAGATGTCGGCGCAACTCTACTCGGAGGAGGGAGGTCTTTGGTCCAGTGGTCTCCAAGTGGTCTCCATCATACGGTTCCGATGGCCGGTTACTTCTACAGCGAGAAATGGTCGGCGTCAACGAAGGCATCAGAAGGCATCATCTCCGCAGCAGAGGCAGAGGCTCCGTTTGGTGGCGTCAAGAGGGTTCCAAACACGGTATCGACGGCATGGGCAACCTCAAGTACGACTGTGAAGTCCGATGGAGGGATCACCCCTTTCATACGCTGTCTTCCACTAGAA

Full Affymetrix probeset data:

Annotations for 1635280_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720