FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635281_at:

>probe:Drosophila_2:1635281_at:627:425; Interrogation_Position=1004; Antisense; GAGAGCAATTCCATTGCCGTGTTCC
>probe:Drosophila_2:1635281_at:60:135; Interrogation_Position=1031; Antisense; ACCCAAGGGCAAGCGCAGCGCAATA
>probe:Drosophila_2:1635281_at:719:651; Interrogation_Position=1054; Antisense; TAATCGCTGAGGACGGCACTTAAAC
>probe:Drosophila_2:1635281_at:460:485; Interrogation_Position=1091; Antisense; GTAGGAATGGCGCACTCCTATGCAC
>probe:Drosophila_2:1635281_at:270:629; Interrogation_Position=1106; Antisense; TCCTATGCACTTCCTATGCACATAT
>probe:Drosophila_2:1635281_at:129:61; Interrogation_Position=1157; Antisense; ATGTCGTTATGTACTGCTGTCGTGT
>probe:Drosophila_2:1635281_at:671:459; Interrogation_Position=626; Antisense; GATTTTATTTCGATGTCCACCGACC
>probe:Drosophila_2:1635281_at:28:413; Interrogation_Position=647; Antisense; GACCTCCTGCTAATCGAAATGCTGA
>probe:Drosophila_2:1635281_at:300:251; Interrogation_Position=673; Antisense; CAAGTTCATCGTTTGCTGCTACGAA
>probe:Drosophila_2:1635281_at:223:379; Interrogation_Position=695; Antisense; GAAGCGCTGTGGACATACCTATACC
>probe:Drosophila_2:1635281_at:480:339; Interrogation_Position=725; Antisense; GCTACGCCGGGCAAGTCGCTGATGA
>probe:Drosophila_2:1635281_at:687:443; Interrogation_Position=835; Antisense; GATGAGGGCTCTGCTTTATCCGCCA
>probe:Drosophila_2:1635281_at:677:19; Interrogation_Position=932; Antisense; ATTTGCGTGTTGATGGTCTTCTTCA
>probe:Drosophila_2:1635281_at:585:643; Interrogation_Position=948; Antisense; TCTTCTTCAAGAACAATCGCACCGC

Paste this into a BLAST search page for me
GAGAGCAATTCCATTGCCGTGTTCCACCCAAGGGCAAGCGCAGCGCAATATAATCGCTGAGGACGGCACTTAAACGTAGGAATGGCGCACTCCTATGCACTCCTATGCACTTCCTATGCACATATATGTCGTTATGTACTGCTGTCGTGTGATTTTATTTCGATGTCCACCGACCGACCTCCTGCTAATCGAAATGCTGACAAGTTCATCGTTTGCTGCTACGAAGAAGCGCTGTGGACATACCTATACCGCTACGCCGGGCAAGTCGCTGATGAGATGAGGGCTCTGCTTTATCCGCCAATTTGCGTGTTGATGGTCTTCTTCATCTTCTTCAAGAACAATCGCACCGC

Full Affymetrix probeset data:

Annotations for 1635281_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720