Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635282_at:

>probe:Drosophila_2:1635282_at:610:153; Interrogation_Position=1047; Antisense; ACAGGAGGCGTTAGCATCTGCACCG
>probe:Drosophila_2:1635282_at:494:631; Interrogation_Position=1077; Antisense; TCCGGCGGACCATTGATTCAGCAGT
>probe:Drosophila_2:1635282_at:175:69; Interrogation_Position=1123; Antisense; AGGCCAACATTGTCATCGGCATTGT
>probe:Drosophila_2:1635282_at:369:361; Interrogation_Position=1156; Antisense; GCAAGATGCCATGCGGCCAGAAGAA
>probe:Drosophila_2:1635282_at:644:375; Interrogation_Position=1175; Antisense; GAAGAACGCGCCCTCGGTCTTTGTT
>probe:Drosophila_2:1635282_at:703:543; Interrogation_Position=1222; Antisense; GGATCAACCAGGTCATCAGCACGGC
>probe:Drosophila_2:1635282_at:692:259; Interrogation_Position=1241; Antisense; CACGGCCACCCACATTATGTAAGAT
>probe:Drosophila_2:1635282_at:477:157; Interrogation_Position=1297; Antisense; ACAACTTAGGCAGATTCGCCCACAA
>probe:Drosophila_2:1635282_at:304:299; Interrogation_Position=1313; Antisense; CGCCCACAAATTAGCGCTCGAATGT
>probe:Drosophila_2:1635282_at:443:37; Interrogation_Position=763; Antisense; ATCTCGGCGGAGTGAATCCCTACGA
>probe:Drosophila_2:1635282_at:534:401; Interrogation_Position=786; Antisense; GACATCGCGCTAATTTACACCAAGG
>probe:Drosophila_2:1635282_at:561:693; Interrogation_Position=822; Antisense; TTTGACACCTATGTCCAGCCAGCAA
>probe:Drosophila_2:1635282_at:103:231; Interrogation_Position=903; Antisense; AATGTCTCGATGACTGCGGTACCCA
>probe:Drosophila_2:1635282_at:108:477; Interrogation_Position=977; Antisense; GTTATGCGAACAGATTCTCGCCCGC

Paste this into a BLAST search page for me
ACAGGAGGCGTTAGCATCTGCACCGTCCGGCGGACCATTGATTCAGCAGTAGGCCAACATTGTCATCGGCATTGTGCAAGATGCCATGCGGCCAGAAGAAGAAGAACGCGCCCTCGGTCTTTGTTGGATCAACCAGGTCATCAGCACGGCCACGGCCACCCACATTATGTAAGATACAACTTAGGCAGATTCGCCCACAACGCCCACAAATTAGCGCTCGAATGTATCTCGGCGGAGTGAATCCCTACGAGACATCGCGCTAATTTACACCAAGGTTTGACACCTATGTCCAGCCAGCAAAATGTCTCGATGACTGCGGTACCCAGTTATGCGAACAGATTCTCGCCCGC

Full Affymetrix probeset data:

Annotations for 1635282_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime