FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635283_at:

>probe:Drosophila_2:1635283_at:585:199; Interrogation_Position=1017; Antisense; AACGCAGGCTACCTAAAGCTCCAAG
>probe:Drosophila_2:1635283_at:567:225; Interrogation_Position=1039; Antisense; AAGGACGCTGCGAACCCATTTGCTC
>probe:Drosophila_2:1635283_at:104:197; Interrogation_Position=1077; Antisense; AACGGACGCTGCATTGGACCGGACA
>probe:Drosophila_2:1635283_at:280:555; Interrogation_Position=1092; Antisense; GGACCGGACATCTGTGAGTGCGCTT
>probe:Drosophila_2:1635283_at:276:621; Interrogation_Position=1110; Antisense; TGCGCTTCCGGTTTCGAGTGGGACC
>probe:Drosophila_2:1635283_at:259:221; Interrogation_Position=1158; Antisense; AAGTGTGACCTTCCGTGCTTGAACG
>probe:Drosophila_2:1635283_at:406:725; Interrogation_Position=1176; Antisense; TTGAACGGCGTCTGTGTGGGCAACA
>probe:Drosophila_2:1635283_at:470:81; Interrogation_Position=1230; Antisense; AGGGACGAGCACCAGCGGAACATCT
>probe:Drosophila_2:1635283_at:160:107; Interrogation_Position=1282; Antisense; AGAACGGTTACTGCAGTGCCCCAAA
>probe:Drosophila_2:1635283_at:722:639; Interrogation_Position=1309; Antisense; TCTGCATCTGCAGGCCGGGATTCAT
>probe:Drosophila_2:1635283_at:605:497; Interrogation_Position=1371; Antisense; GTCTAACTTAGACTTTCGCACTTTA
>probe:Drosophila_2:1635283_at:35:357; Interrogation_Position=1388; Antisense; GCACTTTATTGTTTCGTCTTGGATC
>probe:Drosophila_2:1635283_at:254:203; Interrogation_Position=958; Antisense; AACCAGTGTGCGACAGTTGCGAGAA
>probe:Drosophila_2:1635283_at:3:229; Interrogation_Position=981; Antisense; AATGGCAAGTGCACGGCTCCAGGAC

Paste this into a BLAST search page for me
AACGCAGGCTACCTAAAGCTCCAAGAAGGACGCTGCGAACCCATTTGCTCAACGGACGCTGCATTGGACCGGACAGGACCGGACATCTGTGAGTGCGCTTTGCGCTTCCGGTTTCGAGTGGGACCAAGTGTGACCTTCCGTGCTTGAACGTTGAACGGCGTCTGTGTGGGCAACAAGGGACGAGCACCAGCGGAACATCTAGAACGGTTACTGCAGTGCCCCAAATCTGCATCTGCAGGCCGGGATTCATGTCTAACTTAGACTTTCGCACTTTAGCACTTTATTGTTTCGTCTTGGATCAACCAGTGTGCGACAGTTGCGAGAAAATGGCAAGTGCACGGCTCCAGGAC

Full Affymetrix probeset data:

Annotations for 1635283_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720