FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635285_at:

>probe:Drosophila_2:1635285_at:499:7; Interrogation_Position=192; Antisense; AGAGGCGCTTTTCAAAATCTCGTCC
>probe:Drosophila_2:1635285_at:316:237; Interrogation_Position=207; Antisense; AATCTCGTCCCATTATGCCAAAGTT
>probe:Drosophila_2:1635285_at:693:215; Interrogation_Position=227; Antisense; AAGTTCAGTTCGGACTGCGGCAAAT
>probe:Drosophila_2:1635285_at:578:161; Interrogation_Position=248; Antisense; AAATATCCTTGGCTTCAGGTTCCGA
>probe:Drosophila_2:1635285_at:66:405; Interrogation_Position=317; Antisense; GACTAGATGCGACTGGTCCCATACG
>probe:Drosophila_2:1635285_at:376:325; Interrogation_Position=344; Antisense; GCGAAAAATTCTCCATGCCAGCCAA
>probe:Drosophila_2:1635285_at:491:49; Interrogation_Position=358; Antisense; ATGCCAGCCAAACTTCGCGTGAAGC
>probe:Drosophila_2:1635285_at:438:397; Interrogation_Position=385; Antisense; GACAAGATTCTTTGCCAACTGCGTG
>probe:Drosophila_2:1635285_at:712:87; Interrogation_Position=412; Antisense; AGTCTCGGAGACTTGGTCGGTGCAA
>probe:Drosophila_2:1635285_at:436:359; Interrogation_Position=433; Antisense; GCAACTGGAGTTGGCTTTCACGCAA
>probe:Drosophila_2:1635285_at:440:667; Interrogation_Position=495; Antisense; TACAGGTGCTTCCAATAAGACTCCC
>probe:Drosophila_2:1635285_at:145:393; Interrogation_Position=583; Antisense; GAAAGCAAACCTGCCACTGGATACA
>probe:Drosophila_2:1635285_at:675:455; Interrogation_Position=645; Antisense; GATACACCTTTACCATACCAAGTCA
>probe:Drosophila_2:1635285_at:108:495; Interrogation_Position=666; Antisense; GTCAGCCACTTATTCGAAGATTCGC

Paste this into a BLAST search page for me
AGAGGCGCTTTTCAAAATCTCGTCCAATCTCGTCCCATTATGCCAAAGTTAAGTTCAGTTCGGACTGCGGCAAATAAATATCCTTGGCTTCAGGTTCCGAGACTAGATGCGACTGGTCCCATACGGCGAAAAATTCTCCATGCCAGCCAAATGCCAGCCAAACTTCGCGTGAAGCGACAAGATTCTTTGCCAACTGCGTGAGTCTCGGAGACTTGGTCGGTGCAAGCAACTGGAGTTGGCTTTCACGCAATACAGGTGCTTCCAATAAGACTCCCGAAAGCAAACCTGCCACTGGATACAGATACACCTTTACCATACCAAGTCAGTCAGCCACTTATTCGAAGATTCGC

Full Affymetrix probeset data:

Annotations for 1635285_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720