Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635290_at:

>probe:Drosophila_2:1635290_at:682:711; Interrogation_Position=1738; Antisense; TTCAAGCCGCGCATGGTCGAAGTGA
>probe:Drosophila_2:1635290_at:588:313; Interrogation_Position=1822; Antisense; GCCATAACCTACAAGAGTGCCTCTG
>probe:Drosophila_2:1635290_at:110:671; Interrogation_Position=1878; Antisense; TACGCGCTCCGAACTAAAGCAGCTG
>probe:Drosophila_2:1635290_at:415:545; Interrogation_Position=1906; Antisense; GGATCAGGCAGCTCAGTTCCGACGA
>probe:Drosophila_2:1635290_at:281:419; Interrogation_Position=1929; Antisense; GAGCAGTCCCAATAATCGACGGCGA
>probe:Drosophila_2:1635290_at:191:513; Interrogation_Position=1959; Antisense; GTGATGTTTCCGAGACTGACACCGC
>probe:Drosophila_2:1635290_at:197:545; Interrogation_Position=2003; Antisense; GGATAAGCCACAACTTCACATTCAT
>probe:Drosophila_2:1635290_at:641:257; Interrogation_Position=2019; Antisense; CACATTCATGGTGAGTCCAGCTTAA
>probe:Drosophila_2:1635290_at:226:115; Interrogation_Position=2037; Antisense; AGCTTAAGGTTAGGGCAGCCGCCGT
>probe:Drosophila_2:1635290_at:466:319; Interrogation_Position=2054; Antisense; GCCGCCGTTGGCTGAATTGAATGTT
>probe:Drosophila_2:1635290_at:418:713; Interrogation_Position=2080; Antisense; TTCATACTTTAAAACCTCCTGCTAG
>probe:Drosophila_2:1635290_at:171:505; Interrogation_Position=2114; Antisense; GTCCATGATCGATCCGACTTTGAGT
>probe:Drosophila_2:1635290_at:36:293; Interrogation_Position=2147; Antisense; CGATTGTTGTTGACGAATGCGACCA
>probe:Drosophila_2:1635290_at:390:489; Interrogation_Position=2263; Antisense; GTAAGACATACTTTCCTAGTTCGAG

Paste this into a BLAST search page for me
TTCAAGCCGCGCATGGTCGAAGTGAGCCATAACCTACAAGAGTGCCTCTGTACGCGCTCCGAACTAAAGCAGCTGGGATCAGGCAGCTCAGTTCCGACGAGAGCAGTCCCAATAATCGACGGCGAGTGATGTTTCCGAGACTGACACCGCGGATAAGCCACAACTTCACATTCATCACATTCATGGTGAGTCCAGCTTAAAGCTTAAGGTTAGGGCAGCCGCCGTGCCGCCGTTGGCTGAATTGAATGTTTTCATACTTTAAAACCTCCTGCTAGGTCCATGATCGATCCGACTTTGAGTCGATTGTTGTTGACGAATGCGACCAGTAAGACATACTTTCCTAGTTCGAG

Full Affymetrix probeset data:

Annotations for 1635290_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime