FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635292_at:

>probe:Drosophila_2:1635292_at:720:447; Interrogation_Position=2411; Antisense; GATCCTTCGGCTTTCTAATGATGGA
>probe:Drosophila_2:1635292_at:581:231; Interrogation_Position=2427; Antisense; AATGATGGAGCCCAGCTGGACTCCA
>probe:Drosophila_2:1635292_at:275:589; Interrogation_Position=2453; Antisense; TGGATGCCTTCTACTACGTGTTCAT
>probe:Drosophila_2:1635292_at:65:141; Interrogation_Position=2468; Antisense; ACGTGTTCATCTCGATGTCCACAAT
>probe:Drosophila_2:1635292_at:388:61; Interrogation_Position=2482; Antisense; ATGTCCACAATTGGGTTCGGCGACC
>probe:Drosophila_2:1635292_at:26:473; Interrogation_Position=2496; Antisense; GTTCGGCGACCTGGTGCCCAGTAAT
>probe:Drosophila_2:1635292_at:30:237; Interrogation_Position=2518; Antisense; AATCCCTTCTACGTAATGGTCAGCA
>probe:Drosophila_2:1635292_at:359:453; Interrogation_Position=2544; Antisense; GATCTATCTGATGTTCGGCTTGGCC
>probe:Drosophila_2:1635292_at:549:453; Interrogation_Position=2611; Antisense; GATCACTTCAAAATGGCCAGCGCCA
>probe:Drosophila_2:1635292_at:67:171; Interrogation_Position=2635; Antisense; AAAGTGGGCGCCACCATTGGCATGA
>probe:Drosophila_2:1635292_at:111:569; Interrogation_Position=2653; Antisense; GGCATGAACATGACCAGCGAGCTTG
>probe:Drosophila_2:1635292_at:723:267; Interrogation_Position=2695; Antisense; CAGGTGAAGACTCCCTCCGAGCTTG
>probe:Drosophila_2:1635292_at:463:617; Interrogation_Position=2726; Antisense; TGCACGGTTCGCGACTGGACAGGAT
>probe:Drosophila_2:1635292_at:473:625; Interrogation_Position=2918; Antisense; TGCCCAGGCGTCAGGTTTCCGTGGA

Paste this into a BLAST search page for me
GATCCTTCGGCTTTCTAATGATGGAAATGATGGAGCCCAGCTGGACTCCATGGATGCCTTCTACTACGTGTTCATACGTGTTCATCTCGATGTCCACAATATGTCCACAATTGGGTTCGGCGACCGTTCGGCGACCTGGTGCCCAGTAATAATCCCTTCTACGTAATGGTCAGCAGATCTATCTGATGTTCGGCTTGGCCGATCACTTCAAAATGGCCAGCGCCAAAAGTGGGCGCCACCATTGGCATGAGGCATGAACATGACCAGCGAGCTTGCAGGTGAAGACTCCCTCCGAGCTTGTGCACGGTTCGCGACTGGACAGGATTGCCCAGGCGTCAGGTTTCCGTGGA

Full Affymetrix probeset data:

Annotations for 1635292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720