FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635294_at:

>probe:Drosophila_2:1635294_at:426:697; Interrogation_Position=217; Antisense; TTTATTGGCCGAGGAATCGTCGCCC
>probe:Drosophila_2:1635294_at:487:235; Interrogation_Position=231; Antisense; AATCGTCGCCCGTTGTTAGCCAGGT
>probe:Drosophila_2:1635294_at:693:525; Interrogation_Position=308; Antisense; GGGCACAGACACCATAAGCGGCACT
>probe:Drosophila_2:1635294_at:378:205; Interrogation_Position=323; Antisense; AAGCGGCACTGGGATCACCATTTTC
>probe:Drosophila_2:1635294_at:718:259; Interrogation_Position=365; Antisense; CACCCTGCCAGATTCGGGTTTGGAT
>probe:Drosophila_2:1635294_at:225:95; Interrogation_Position=428; Antisense; AGATTCGAGCCACATGACTTCCAAC
>probe:Drosophila_2:1635294_at:395:717; Interrogation_Position=446; Antisense; TTCCAACCGTTTCCAAATGCCTTTG
>probe:Drosophila_2:1635294_at:247:165; Interrogation_Position=460; Antisense; AAATGCCTTTGGACCACCGGAATAT
>probe:Drosophila_2:1635294_at:55:243; Interrogation_Position=480; Antisense; AATATGAGGAGCACCGGCGGCCATT
>probe:Drosophila_2:1635294_at:347:123; Interrogation_Position=508; Antisense; AGCGCCACTGGAGCCTTTTGAAGAA
>probe:Drosophila_2:1635294_at:712:373; Interrogation_Position=695; Antisense; GAAGAGGCACCCTTGGCCATCGACA
>probe:Drosophila_2:1635294_at:497:43; Interrogation_Position=713; Antisense; ATCGACATACGCATCGGCTGACGAA
>probe:Drosophila_2:1635294_at:595:39; Interrogation_Position=725; Antisense; ATCGGCTGACGAACCTAGACCTAAG
>probe:Drosophila_2:1635294_at:7:227; Interrogation_Position=747; Antisense; AAGGCTCCATTCTATCTTATGCATT

Paste this into a BLAST search page for me
TTTATTGGCCGAGGAATCGTCGCCCAATCGTCGCCCGTTGTTAGCCAGGTGGGCACAGACACCATAAGCGGCACTAAGCGGCACTGGGATCACCATTTTCCACCCTGCCAGATTCGGGTTTGGATAGATTCGAGCCACATGACTTCCAACTTCCAACCGTTTCCAAATGCCTTTGAAATGCCTTTGGACCACCGGAATATAATATGAGGAGCACCGGCGGCCATTAGCGCCACTGGAGCCTTTTGAAGAAGAAGAGGCACCCTTGGCCATCGACAATCGACATACGCATCGGCTGACGAAATCGGCTGACGAACCTAGACCTAAGAAGGCTCCATTCTATCTTATGCATT

Full Affymetrix probeset data:

Annotations for 1635294_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720