FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635298_at:

>probe:Drosophila_2:1635298_at:47:107; Interrogation_Position=1610; Antisense; AGAAATGGGAACTCTTCCTGCTCCA
>probe:Drosophila_2:1635298_at:164:199; Interrogation_Position=1638; Antisense; AACGCCAGCGGTGAAAACTCTGAAT
>probe:Drosophila_2:1635298_at:268:231; Interrogation_Position=1727; Antisense; AATGCTGCCGTTTCTGCAGAAAAGC
>probe:Drosophila_2:1635298_at:314:101; Interrogation_Position=1804; Antisense; AGAGAATCGCACTTTCTTCAGCCGA
>probe:Drosophila_2:1635298_at:72:459; Interrogation_Position=1833; Antisense; GATTTGCTTCTTTAACTGCGGTCTG
>probe:Drosophila_2:1635298_at:463:193; Interrogation_Position=1846; Antisense; AACTGCGGTCTGTACCGATCAACTG
>probe:Drosophila_2:1635298_at:614:453; Interrogation_Position=1862; Antisense; GATCAACTGGTTTCGCTCTGGAGGA
>probe:Drosophila_2:1635298_at:75:589; Interrogation_Position=1880; Antisense; TGGAGGATACTTGGCCAGATACCAT
>probe:Drosophila_2:1635298_at:594:95; Interrogation_Position=1896; Antisense; AGATACCATTCAAGCTGCACTCAAT
>probe:Drosophila_2:1635298_at:388:625; Interrogation_Position=1927; Antisense; TGCCCCATCGTAGTTACTTCCTATA
>probe:Drosophila_2:1635298_at:354:137; Interrogation_Position=1958; Antisense; ACGAGGCCCCTTTGGATATGATTCA
>probe:Drosophila_2:1635298_at:287:709; Interrogation_Position=2008; Antisense; TTAAATGTCGTAATGCCGCCAACTG
>probe:Drosophila_2:1635298_at:646:43; Interrogation_Position=2020; Antisense; ATGCCGCCAACTGTAAATCCGTTTT
>probe:Drosophila_2:1635298_at:660:465; Interrogation_Position=2122; Antisense; GTTGATTAATCGCAGTCCACACCTT

Paste this into a BLAST search page for me
AGAAATGGGAACTCTTCCTGCTCCAAACGCCAGCGGTGAAAACTCTGAATAATGCTGCCGTTTCTGCAGAAAAGCAGAGAATCGCACTTTCTTCAGCCGAGATTTGCTTCTTTAACTGCGGTCTGAACTGCGGTCTGTACCGATCAACTGGATCAACTGGTTTCGCTCTGGAGGATGGAGGATACTTGGCCAGATACCATAGATACCATTCAAGCTGCACTCAATTGCCCCATCGTAGTTACTTCCTATAACGAGGCCCCTTTGGATATGATTCATTAAATGTCGTAATGCCGCCAACTGATGCCGCCAACTGTAAATCCGTTTTGTTGATTAATCGCAGTCCACACCTT

Full Affymetrix probeset data:

Annotations for 1635298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720