Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635299_at:

>probe:Drosophila_2:1635299_at:182:41; Interrogation_Position=2679; Antisense; ATCGGATCAGATTGTGGCAGACTAC
>probe:Drosophila_2:1635299_at:136:403; Interrogation_Position=2698; Antisense; GACTACATTGATGATCTGCCTGATT
>probe:Drosophila_2:1635299_at:302:625; Interrogation_Position=2714; Antisense; TGCCTGATTTCGTGAATCCCCATAT
>probe:Drosophila_2:1635299_at:152:21; Interrogation_Position=2735; Antisense; ATATTCTGAAGCTCATCTCACATCC
>probe:Drosophila_2:1635299_at:642:311; Interrogation_Position=2835; Antisense; GCCAAAGCCGAATGACGTGGATCTT
>probe:Drosophila_2:1635299_at:286:689; Interrogation_Position=2859; Antisense; TATTCTCAAGCAGGTTTCTCGTATG
>probe:Drosophila_2:1635299_at:341:415; Interrogation_Position=2893; Antisense; GACCAATTGGACCACGTGTGCGATG
>probe:Drosophila_2:1635299_at:186:721; Interrogation_Position=2964; Antisense; TTGCTGCTGGCACGTGGCTTATAAG
>probe:Drosophila_2:1635299_at:114:427; Interrogation_Position=2998; Antisense; GAGAGTATCCAGAACCAAATGCTTA
>probe:Drosophila_2:1635299_at:324:617; Interrogation_Position=3064; Antisense; TGCATAAAGTGCTCCTAAGACCCTG
>probe:Drosophila_2:1635299_at:454:213; Interrogation_Position=3080; Antisense; AAGACCCTGGACATTTAGAACGGAT
>probe:Drosophila_2:1635299_at:707:681; Interrogation_Position=3151; Antisense; TATGAATGCGGCCAGCTGATAATGT
>probe:Drosophila_2:1635299_at:483:415; Interrogation_Position=3180; Antisense; GAGCCATTAGTTTATAAGCCATCCA
>probe:Drosophila_2:1635299_at:199:205; Interrogation_Position=3195; Antisense; AAGCCATCCATTAATTCGAGCCAAA

Paste this into a BLAST search page for me
ATCGGATCAGATTGTGGCAGACTACGACTACATTGATGATCTGCCTGATTTGCCTGATTTCGTGAATCCCCATATATATTCTGAAGCTCATCTCACATCCGCCAAAGCCGAATGACGTGGATCTTTATTCTCAAGCAGGTTTCTCGTATGGACCAATTGGACCACGTGTGCGATGTTGCTGCTGGCACGTGGCTTATAAGGAGAGTATCCAGAACCAAATGCTTATGCATAAAGTGCTCCTAAGACCCTGAAGACCCTGGACATTTAGAACGGATTATGAATGCGGCCAGCTGATAATGTGAGCCATTAGTTTATAAGCCATCCAAAGCCATCCATTAATTCGAGCCAAA

Full Affymetrix probeset data:

Annotations for 1635299_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime