FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635300_at:

>probe:Drosophila_2:1635300_at:178:255; Interrogation_Position=113; Antisense; CAAAGGACCTCACCAGAATCTGATC
>probe:Drosophila_2:1635300_at:337:605; Interrogation_Position=133; Antisense; TGATCCGCTGCATCCTGATGCTGAC
>probe:Drosophila_2:1635300_at:652:583; Interrogation_Position=171; Antisense; TGGCTCTTCTGGCTATGTTGCTACA
>probe:Drosophila_2:1635300_at:585:571; Interrogation_Position=181; Antisense; GGCTATGTTGCTACATGGCCCAAAT
>probe:Drosophila_2:1635300_at:489:581; Interrogation_Position=196; Antisense; TGGCCCAAATGAATCCCTTGATCGG
>probe:Drosophila_2:1635300_at:145:723; Interrogation_Position=213; Antisense; TTGATCGGGCCCAAACTAAAGCGCG
>probe:Drosophila_2:1635300_at:199:279; Interrogation_Position=228; Antisense; CTAAAGCGCGATGTGGTGGCCATGA
>probe:Drosophila_2:1635300_at:598:369; Interrogation_Position=256; Antisense; GAAGGTCCTGGAACAACCCAATTGT
>probe:Drosophila_2:1635300_at:729:103; Interrogation_Position=272; Antisense; CCCAATTGTGGCTGGTTAGGAAAAT
>probe:Drosophila_2:1635300_at:638:511; Interrogation_Position=300; Antisense; GTGACTGCTAACTAAATTATTCTGC
>probe:Drosophila_2:1635300_at:626:229; Interrogation_Position=32; Antisense; AATGGGTGCCGCTTTCTTTCCCGTG
>probe:Drosophila_2:1635300_at:373:655; Interrogation_Position=327; Antisense; TAATCGTCACATTAGCTGTTTGTTT
>probe:Drosophila_2:1635300_at:243:81; Interrogation_Position=381; Antisense; AGTGTTCTGTTAACTTCGAATTGTT
>probe:Drosophila_2:1635300_at:249:505; Interrogation_Position=54; Antisense; GTGCTGTTTTTCACCGCCTTGTGGG

Paste this into a BLAST search page for me
CAAAGGACCTCACCAGAATCTGATCTGATCCGCTGCATCCTGATGCTGACTGGCTCTTCTGGCTATGTTGCTACAGGCTATGTTGCTACATGGCCCAAATTGGCCCAAATGAATCCCTTGATCGGTTGATCGGGCCCAAACTAAAGCGCGCTAAAGCGCGATGTGGTGGCCATGAGAAGGTCCTGGAACAACCCAATTGTCCCAATTGTGGCTGGTTAGGAAAATGTGACTGCTAACTAAATTATTCTGCAATGGGTGCCGCTTTCTTTCCCGTGTAATCGTCACATTAGCTGTTTGTTTAGTGTTCTGTTAACTTCGAATTGTTGTGCTGTTTTTCACCGCCTTGTGGG

Full Affymetrix probeset data:

Annotations for 1635300_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720