Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635301_at:

>probe:Drosophila_2:1635301_at:464:693; Interrogation_Position=1029; Antisense; TTTGCAGCGCTATACTGATCCGACA
>probe:Drosophila_2:1635301_at:545:135; Interrogation_Position=1067; Antisense; ACGACTTCAACGAGGTTGCCGAGCA
>probe:Drosophila_2:1635301_at:692:247; Interrogation_Position=1100; Antisense; AATTGAGTGACTGCGCACTGCATCG
>probe:Drosophila_2:1635301_at:198:587; Interrogation_Position=1160; Antisense; TGGACATTAGCTTCCATACGGCCTC
>probe:Drosophila_2:1635301_at:485:353; Interrogation_Position=1198; Antisense; GCAGCCGCAGTATTGCACAATCTAC
>probe:Drosophila_2:1635301_at:475:383; Interrogation_Position=1228; Antisense; GAACTGAGCGAACCACACATGCTTG
>probe:Drosophila_2:1635301_at:672:525; Interrogation_Position=1257; Antisense; GGGCAACTCGGTGGACGTGTCCAAA
>probe:Drosophila_2:1635301_at:52:409; Interrogation_Position=1270; Antisense; GACGTGTCCAAATTCCGGGCAGAGC
>probe:Drosophila_2:1635301_at:372:351; Interrogation_Position=1288; Antisense; GCAGAGCCGCTGTCAGATTCAGTCA
>probe:Drosophila_2:1635301_at:505:511; Interrogation_Position=1345; Antisense; GTGAGAGATTTCCTAGCCAGAACTA
>probe:Drosophila_2:1635301_at:500:203; Interrogation_Position=1409; Antisense; AACCACCGACTTCTCATATACATAA
>probe:Drosophila_2:1635301_at:133:29; Interrogation_Position=929; Antisense; ATACTCTTACCGCAATCCCTGAATT
>probe:Drosophila_2:1635301_at:194:247; Interrogation_Position=950; Antisense; AATTCCGCATTAATTCCCGACTAGT
>probe:Drosophila_2:1635301_at:698:721; Interrogation_Position=988; Antisense; TTGGCCCCGGTGTACCAGAATTATC

Paste this into a BLAST search page for me
TTTGCAGCGCTATACTGATCCGACAACGACTTCAACGAGGTTGCCGAGCAAATTGAGTGACTGCGCACTGCATCGTGGACATTAGCTTCCATACGGCCTCGCAGCCGCAGTATTGCACAATCTACGAACTGAGCGAACCACACATGCTTGGGGCAACTCGGTGGACGTGTCCAAAGACGTGTCCAAATTCCGGGCAGAGCGCAGAGCCGCTGTCAGATTCAGTCAGTGAGAGATTTCCTAGCCAGAACTAAACCACCGACTTCTCATATACATAAATACTCTTACCGCAATCCCTGAATTAATTCCGCATTAATTCCCGACTAGTTTGGCCCCGGTGTACCAGAATTATC

Full Affymetrix probeset data:

Annotations for 1635301_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime