FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635302_at:

>probe:Drosophila_2:1635302_at:468:411; Interrogation_Position=4238; Antisense; GACCCAGGACATGGAGTATCTTCAC
>probe:Drosophila_2:1635302_at:166:269; Interrogation_Position=4247; Antisense; CATGGAGTATCTTCACAAATGTGGT
>probe:Drosophila_2:1635302_at:707:229; Interrogation_Position=4264; Antisense; AATGTGGTGTGCAGGTGCTCAGCCA
>probe:Drosophila_2:1635302_at:216:81; Interrogation_Position=4276; Antisense; AGGTGCTCAGCCAGATTGCCATCAA
>probe:Drosophila_2:1635302_at:528:313; Interrogation_Position=4285; Antisense; GCCAGATTGCCATCAACGCATATTT
>probe:Drosophila_2:1635302_at:689:21; Interrogation_Position=4304; Antisense; ATATTTGATGAACGGCAGGGATGCC
>probe:Drosophila_2:1635302_at:425:451; Interrogation_Position=4329; Antisense; GATCTGGGAAAGTACCAGCTCCTTT
>probe:Drosophila_2:1635302_at:521:487; Interrogation_Position=4340; Antisense; GTACCAGCTCCTTTGAACGAATCAT
>probe:Drosophila_2:1635302_at:262:463; Interrogation_Position=4367; Antisense; GATTCTTTGTACATGCATTGGATTT
>probe:Drosophila_2:1635302_at:108:695; Interrogation_Position=4394; Antisense; TTTTTTGTTCCTGTTCTATATTTTG
>probe:Drosophila_2:1635302_at:314:23; Interrogation_Position=4476; Antisense; ATAGGTCTAGTTTAATCAGTTGTAA
>probe:Drosophila_2:1635302_at:585:689; Interrogation_Position=4562; Antisense; TTTGGAAGCCTTTAGCGTAATGAAT
>probe:Drosophila_2:1635302_at:28:293; Interrogation_Position=4626; Antisense; CGAACTGAAATTGAAGTCCATTTGA
>probe:Drosophila_2:1635302_at:514:11; Interrogation_Position=4692; Antisense; ATTAATTCTAAGTCAAAGCGCAAAT

Paste this into a BLAST search page for me
GACCCAGGACATGGAGTATCTTCACCATGGAGTATCTTCACAAATGTGGTAATGTGGTGTGCAGGTGCTCAGCCAAGGTGCTCAGCCAGATTGCCATCAAGCCAGATTGCCATCAACGCATATTTATATTTGATGAACGGCAGGGATGCCGATCTGGGAAAGTACCAGCTCCTTTGTACCAGCTCCTTTGAACGAATCATGATTCTTTGTACATGCATTGGATTTTTTTTTGTTCCTGTTCTATATTTTGATAGGTCTAGTTTAATCAGTTGTAATTTGGAAGCCTTTAGCGTAATGAATCGAACTGAAATTGAAGTCCATTTGAATTAATTCTAAGTCAAAGCGCAAAT

Full Affymetrix probeset data:

Annotations for 1635302_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720