FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635303_at:

>probe:Drosophila_2:1635303_at:545:285; Interrogation_Position=120; Antisense; CTGTCCCATCCTGGCTGAAACTGAA
>probe:Drosophila_2:1635303_at:454:109; Interrogation_Position=183; Antisense; AGAAGGGTCTGACTCCCTCCAAAAT
>probe:Drosophila_2:1635303_at:340:185; Interrogation_Position=203; Antisense; AAAATCGGCATCATCCTGCGTGACT
>probe:Drosophila_2:1635303_at:132:427; Interrogation_Position=234; Antisense; GAGTTGCCCAGGTGCGTTTCGTCAA
>probe:Drosophila_2:1635303_at:387:97; Interrogation_Position=267; Antisense; AGATCCTGCGCATCATGAAGTCGGT
>probe:Drosophila_2:1635303_at:188:719; Interrogation_Position=309; Antisense; TTCCCGAGGATCTGTACCACATGAT
>probe:Drosophila_2:1635303_at:387:151; Interrogation_Position=327; Antisense; ACATGATCAAGAAGGCCGTCGCCAT
>probe:Drosophila_2:1635303_at:18:361; Interrogation_Position=354; Antisense; GCAAGCACTTGGAGCGCAACCGCAA
>probe:Drosophila_2:1635303_at:168:361; Interrogation_Position=390; Antisense; GCAAGTTCCGTCTGATTCTGGTCGA
>probe:Drosophila_2:1635303_at:687:581; Interrogation_Position=432; Antisense; TGGCCCGCTACTACAAGACCAAGAG
>probe:Drosophila_2:1635303_at:459:395; Interrogation_Position=475; Antisense; GAAATACGAGTCGAGCACTGCCTCC
>probe:Drosophila_2:1635303_at:717:541; Interrogation_Position=505; Antisense; GGTTGCCTAAGTTCTTGATTCGCTA
>probe:Drosophila_2:1635303_at:328:215; Interrogation_Position=56; Antisense; AAGATGGGTCGTATGCACGCTCCTG
>probe:Drosophila_2:1635303_at:245:135; Interrogation_Position=72; Antisense; ACGCTCCTGGCAAGGGTATTTCCCA

Paste this into a BLAST search page for me
CTGTCCCATCCTGGCTGAAACTGAAAGAAGGGTCTGACTCCCTCCAAAATAAAATCGGCATCATCCTGCGTGACTGAGTTGCCCAGGTGCGTTTCGTCAAAGATCCTGCGCATCATGAAGTCGGTTTCCCGAGGATCTGTACCACATGATACATGATCAAGAAGGCCGTCGCCATGCAAGCACTTGGAGCGCAACCGCAAGCAAGTTCCGTCTGATTCTGGTCGATGGCCCGCTACTACAAGACCAAGAGGAAATACGAGTCGAGCACTGCCTCCGGTTGCCTAAGTTCTTGATTCGCTAAAGATGGGTCGTATGCACGCTCCTGACGCTCCTGGCAAGGGTATTTCCCA

Full Affymetrix probeset data:

Annotations for 1635303_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720