Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635304_at:

>probe:Drosophila_2:1635304_at:454:23; Interrogation_Position=1479; Antisense; ATATGGCGTGGATCCCAGTGCCGTC
>probe:Drosophila_2:1635304_at:369:259; Interrogation_Position=1494; Antisense; CAGTGCCGTCGTGATTCCCATGGAG
>probe:Drosophila_2:1635304_at:269:191; Interrogation_Position=1568; Antisense; AACTATACCGGATGACCTCAACGTC
>probe:Drosophila_2:1635304_at:221:219; Interrogation_Position=1750; Antisense; AAGTACAAGCGCCATCATCGTTGCT
>probe:Drosophila_2:1635304_at:64:161; Interrogation_Position=1802; Antisense; ACAACGGACTCCAGCACTATGTGCA
>probe:Drosophila_2:1635304_at:507:277; Interrogation_Position=1818; Antisense; CTATGTGCACGTGCTCGGTATCAAT
>probe:Drosophila_2:1635304_at:136:545; Interrogation_Position=1845; Antisense; GGATACACAGCAGCCCATACAATGC
>probe:Drosophila_2:1635304_at:302:665; Interrogation_Position=1862; Antisense; TACAATGCCCGTACGGTGAGGACTC
>probe:Drosophila_2:1635304_at:275:657; Interrogation_Position=1947; Antisense; TAAAATCGACGACCTTGAGCAGATG
>probe:Drosophila_2:1635304_at:717:607; Interrogation_Position=1962; Antisense; TGAGCAGATGGTCCCCAGTGGTCAT
>probe:Drosophila_2:1635304_at:679:83; Interrogation_Position=1978; Antisense; AGTGGTCATCAGAGGCATCGCCGAA
>probe:Drosophila_2:1635304_at:333:393; Interrogation_Position=2000; Antisense; GAAAGCATCGCCAGCAAGACACATT
>probe:Drosophila_2:1635304_at:453:397; Interrogation_Position=2017; Antisense; GACACATTGGCCTTGATGGCCGGGC
>probe:Drosophila_2:1635304_at:431:437; Interrogation_Position=2031; Antisense; GATGGCCGGGCCAAAATCGGTTTGA

Paste this into a BLAST search page for me
ATATGGCGTGGATCCCAGTGCCGTCCAGTGCCGTCGTGATTCCCATGGAGAACTATACCGGATGACCTCAACGTCAAGTACAAGCGCCATCATCGTTGCTACAACGGACTCCAGCACTATGTGCACTATGTGCACGTGCTCGGTATCAATGGATACACAGCAGCCCATACAATGCTACAATGCCCGTACGGTGAGGACTCTAAAATCGACGACCTTGAGCAGATGTGAGCAGATGGTCCCCAGTGGTCATAGTGGTCATCAGAGGCATCGCCGAAGAAAGCATCGCCAGCAAGACACATTGACACATTGGCCTTGATGGCCGGGCGATGGCCGGGCCAAAATCGGTTTGA

Full Affymetrix probeset data:

Annotations for 1635304_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime