Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635307_at:

>probe:Drosophila_2:1635307_at:551:237; Interrogation_Position=1705; Antisense; AATCGGCTCTTGATTGCCATTGTTT
>probe:Drosophila_2:1635307_at:237:107; Interrogation_Position=1820; Antisense; AGAAAATGCAGCTCGTTACCAAGCA
>probe:Drosophila_2:1635307_at:167:475; Interrogation_Position=1834; Antisense; GTTACCAAGCATCAAGTTATTCATC
>probe:Drosophila_2:1635307_at:713:389; Interrogation_Position=1863; Antisense; GAAACATTCCATTATTGAACTGTAG
>probe:Drosophila_2:1635307_at:487:383; Interrogation_Position=1879; Antisense; GAACTGTAGAACTAAGTGCTTTTAT
>probe:Drosophila_2:1635307_at:657:633; Interrogation_Position=1927; Antisense; TCGCTTGTCAAGGATCTCCACGAAT
>probe:Drosophila_2:1635307_at:512:537; Interrogation_Position=1970; Antisense; GGTAGGTGTGTCTTAACTAATGCAT
>probe:Drosophila_2:1635307_at:597:177; Interrogation_Position=2026; Antisense; AAACTCGAACTATTTGTCTAGATCA
>probe:Drosophila_2:1635307_at:646:497; Interrogation_Position=2041; Antisense; GTCTAGATCAACTTGCACTTGGGCA
>probe:Drosophila_2:1635307_at:165:723; Interrogation_Position=2053; Antisense; TTGCACTTGGGCATTGAACAAAATC
>probe:Drosophila_2:1635307_at:385:91; Interrogation_Position=2090; Antisense; AGTTAAATTCCGTGCATTCGACAGA
>probe:Drosophila_2:1635307_at:660:343; Interrogation_Position=2103; Antisense; GCATTCGACAGAAGACACACTACAT
>probe:Drosophila_2:1635307_at:708:397; Interrogation_Position=2116; Antisense; GACACACTACATTATTCTTACTTGG
>probe:Drosophila_2:1635307_at:482:645; Interrogation_Position=2155; Antisense; TCATTTGTTTACTTACCGTTGAATA

Paste this into a BLAST search page for me
AATCGGCTCTTGATTGCCATTGTTTAGAAAATGCAGCTCGTTACCAAGCAGTTACCAAGCATCAAGTTATTCATCGAAACATTCCATTATTGAACTGTAGGAACTGTAGAACTAAGTGCTTTTATTCGCTTGTCAAGGATCTCCACGAATGGTAGGTGTGTCTTAACTAATGCATAAACTCGAACTATTTGTCTAGATCAGTCTAGATCAACTTGCACTTGGGCATTGCACTTGGGCATTGAACAAAATCAGTTAAATTCCGTGCATTCGACAGAGCATTCGACAGAAGACACACTACATGACACACTACATTATTCTTACTTGGTCATTTGTTTACTTACCGTTGAATA

Full Affymetrix probeset data:

Annotations for 1635307_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime