FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635313_at:

>probe:Drosophila_2:1635313_at:73:349; Interrogation_Position=255; Antisense; GCATGAGCAGCAGCCGCGGGAATTC
>probe:Drosophila_2:1635313_at:254:83; Interrogation_Position=290; Antisense; AGGGCAGCATCATGCGTACCTCGGG
>probe:Drosophila_2:1635313_at:53:651; Interrogation_Position=324; Antisense; TCAGCCGGTGAAAGCCATCTACAAG
>probe:Drosophila_2:1635313_at:467:557; Interrogation_Position=369; Antisense; GGACATGAACTTCGACGTGGCCCTT
>probe:Drosophila_2:1635313_at:371:671; Interrogation_Position=395; Antisense; TACGAACAGCGGACGGAGCACTCAG
>probe:Drosophila_2:1635313_at:481:3; Interrogation_Position=445; Antisense; ATTCGATTGCCCACCGTTGGCGAGG
>probe:Drosophila_2:1635313_at:269:505; Interrogation_Position=532; Antisense; GTCCTGTCGTCGGTACTCAAAAGCA
>probe:Drosophila_2:1635313_at:381:173; Interrogation_Position=551; Antisense; AAAGCACTACGGTACTGACAGTCAA
>probe:Drosophila_2:1635313_at:1:489; Interrogation_Position=616; Antisense; GTCACCGAAGCTGGAGGTCCGATCA
>probe:Drosophila_2:1635313_at:271:435; Interrogation_Position=629; Antisense; GAGGTCCGATCAGCGCACAGGGAAC
>probe:Drosophila_2:1635313_at:287:381; Interrogation_Position=650; Antisense; GAACCCTTATCGGAATCGTATCCTG
>probe:Drosophila_2:1635313_at:283:461; Interrogation_Position=696; Antisense; GTACTATCCAGGAGTTTACACCCGC
>probe:Drosophila_2:1635313_at:252:667; Interrogation_Position=732; Antisense; TACTATACGCCGTTGGATACGCCTG
>probe:Drosophila_2:1635313_at:161:543; Interrogation_Position=746; Antisense; GGATACGCCTGCTCACAAAGTTGTA

Paste this into a BLAST search page for me
GCATGAGCAGCAGCCGCGGGAATTCAGGGCAGCATCATGCGTACCTCGGGTCAGCCGGTGAAAGCCATCTACAAGGGACATGAACTTCGACGTGGCCCTTTACGAACAGCGGACGGAGCACTCAGATTCGATTGCCCACCGTTGGCGAGGGTCCTGTCGTCGGTACTCAAAAGCAAAAGCACTACGGTACTGACAGTCAAGTCACCGAAGCTGGAGGTCCGATCAGAGGTCCGATCAGCGCACAGGGAACGAACCCTTATCGGAATCGTATCCTGGTACTATCCAGGAGTTTACACCCGCTACTATACGCCGTTGGATACGCCTGGGATACGCCTGCTCACAAAGTTGTA

Full Affymetrix probeset data:

Annotations for 1635313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720