FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635314_at:

>probe:Drosophila_2:1635314_at:509:325; Interrogation_Position=141; Antisense; GCGAGAGAAAGTCATCCCTGGCACC
>probe:Drosophila_2:1635314_at:283:695; Interrogation_Position=168; Antisense; TTTCGCCATGTCCAATTCCGGATAT
>probe:Drosophila_2:1635314_at:484:79; Interrogation_Position=224; Antisense; AGGGATCTTAATCGGACCCTCAAGA
>probe:Drosophila_2:1635314_at:536:555; Interrogation_Position=237; Antisense; GGACCCTCAAGATGCGTGGCCTGAA
>probe:Drosophila_2:1635314_at:216:427; Interrogation_Position=269; Antisense; GAGATCGTTCGGATGAAGCAGCGCC
>probe:Drosophila_2:1635314_at:701:347; Interrogation_Position=286; Antisense; GCAGCGCCGGAGAACCTTAAAGAAT
>probe:Drosophila_2:1635314_at:726:209; Interrogation_Position=305; Antisense; AAGAATCGCGGATACGCAGCCAGTT
>probe:Drosophila_2:1635314_at:401:127; Interrogation_Position=322; Antisense; AGCCAGTTGCCGCATCAAGAGAATC
>probe:Drosophila_2:1635314_at:211:625; Interrogation_Position=426; Antisense; TGCGCCGCGAGGTGTCCAACTGGAA
>probe:Drosophila_2:1635314_at:171:617; Interrogation_Position=471; Antisense; TGCAGTTCGCCATCCAGAACGAGAT
>probe:Drosophila_2:1635314_at:169:383; Interrogation_Position=487; Antisense; GAACGAGATACCCATTCCCAGCGAG
>probe:Drosophila_2:1635314_at:693:619; Interrogation_Position=521; Antisense; TGCTGAACGATTGCCCAGTCACATT
>probe:Drosophila_2:1635314_at:551:495; Interrogation_Position=538; Antisense; GTCACATTCCTGTTTCTGTCAAAAT
>probe:Drosophila_2:1635314_at:59:243; Interrogation_Position=607; Antisense; AATAGCTGGCAAATATCCTTCCTCA

Paste this into a BLAST search page for me
GCGAGAGAAAGTCATCCCTGGCACCTTTCGCCATGTCCAATTCCGGATATAGGGATCTTAATCGGACCCTCAAGAGGACCCTCAAGATGCGTGGCCTGAAGAGATCGTTCGGATGAAGCAGCGCCGCAGCGCCGGAGAACCTTAAAGAATAAGAATCGCGGATACGCAGCCAGTTAGCCAGTTGCCGCATCAAGAGAATCTGCGCCGCGAGGTGTCCAACTGGAATGCAGTTCGCCATCCAGAACGAGATGAACGAGATACCCATTCCCAGCGAGTGCTGAACGATTGCCCAGTCACATTGTCACATTCCTGTTTCTGTCAAAATAATAGCTGGCAAATATCCTTCCTCA

Full Affymetrix probeset data:

Annotations for 1635314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720