FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635317_at:

>probe:Drosophila_2:1635317_at:617:79; Interrogation_Position=357; Antisense; AGGTCACTCTGTTTTCGTGGACTCA
>probe:Drosophila_2:1635317_at:565:521; Interrogation_Position=448; Antisense; GTGGCTCAACTTTTTGTCTGCGGAA
>probe:Drosophila_2:1635317_at:220:545; Interrogation_Position=477; Antisense; GGATCATCCGCGTAAGACTGTCGAA
>probe:Drosophila_2:1635317_at:317:221; Interrogation_Position=500; Antisense; AAGTGAATATCCTTCCACAGTCGGA
>probe:Drosophila_2:1635317_at:238:501; Interrogation_Position=519; Antisense; GTCGGATTATCCTGGTCGTAGTTAT
>probe:Drosophila_2:1635317_at:412:73; Interrogation_Position=550; Antisense; AGAGAACCCGTTTCCCTGATAGAGG
>probe:Drosophila_2:1635317_at:428:487; Interrogation_Position=609; Antisense; GTACCTTCTGAAAACCATCGATCTC
>probe:Drosophila_2:1635317_at:93:453; Interrogation_Position=628; Antisense; GATCTCTGCACTGCCCATATAAATG
>probe:Drosophila_2:1635317_at:539:53; Interrogation_Position=653; Antisense; ATGAGAGCTTCAGGGTTCCATTCAA
>probe:Drosophila_2:1635317_at:351:125; Interrogation_Position=708; Antisense; AGCCGTGGTGCTCTATTCAGATATT
>probe:Drosophila_2:1635317_at:642:699; Interrogation_Position=757; Antisense; TTTAGGCTCATGTTTTCCACTGGTC
>probe:Drosophila_2:1635317_at:639:63; Interrogation_Position=823; Antisense; ATGGATAATCCCGTCGAGGTGGCCA
>probe:Drosophila_2:1635317_at:82:113; Interrogation_Position=896; Antisense; AGCATCGCGAAGTGGAGTACTCCTT
>probe:Drosophila_2:1635317_at:346:725; Interrogation_Position=925; Antisense; TTGGGCAGTTCCACAGTCGCAAATC

Paste this into a BLAST search page for me
AGGTCACTCTGTTTTCGTGGACTCAGTGGCTCAACTTTTTGTCTGCGGAAGGATCATCCGCGTAAGACTGTCGAAAAGTGAATATCCTTCCACAGTCGGAGTCGGATTATCCTGGTCGTAGTTATAGAGAACCCGTTTCCCTGATAGAGGGTACCTTCTGAAAACCATCGATCTCGATCTCTGCACTGCCCATATAAATGATGAGAGCTTCAGGGTTCCATTCAAAGCCGTGGTGCTCTATTCAGATATTTTTAGGCTCATGTTTTCCACTGGTCATGGATAATCCCGTCGAGGTGGCCAAGCATCGCGAAGTGGAGTACTCCTTTTGGGCAGTTCCACAGTCGCAAATC

Full Affymetrix probeset data:

Annotations for 1635317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720