FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635318_at:

>probe:Drosophila_2:1635318_at:359:695; Interrogation_Position=1050; Antisense; TTTGCCACACCTAAAGTCCTTGATT
>probe:Drosophila_2:1635318_at:579:311; Interrogation_Position=1080; Antisense; GCCAAGTTGTGACGCCCTAGATAAG
>probe:Drosophila_2:1635318_at:490:215; Interrogation_Position=1102; Antisense; AAGATTTCGGAGGACCTGCACTTGC
>probe:Drosophila_2:1635318_at:293:131; Interrogation_Position=1136; Antisense; ACCGAGGCGATCTTTTGGGATTCCG
>probe:Drosophila_2:1635318_at:647:591; Interrogation_Position=1151; Antisense; TGGGATTCCGAAACATGGGCGCCTA
>probe:Drosophila_2:1635318_at:489:211; Interrogation_Position=1219; Antisense; AAGACCCTGTACTTCCAAGCTATAT
>probe:Drosophila_2:1635318_at:50:717; Interrogation_Position=703; Antisense; TTCGGCGCACTACTGGGCTATGACA
>probe:Drosophila_2:1635318_at:305:571; Interrogation_Position=718; Antisense; GGCTATGACATGGACTTTCTGGACA
>probe:Drosophila_2:1635318_at:729:539; Interrogation_Position=752; Antisense; GGTTCCCTGGCAGCGATGACGTAAA
>probe:Drosophila_2:1635318_at:628:363; Interrogation_Position=801; Antisense; GAATACCTCGGTGCAGCGTCATTTT
>probe:Drosophila_2:1635318_at:245:591; Interrogation_Position=890; Antisense; TGGTTTGCAAGATCCACGCCAAGCG
>probe:Drosophila_2:1635318_at:159:379; Interrogation_Position=928; Antisense; GAAGCTGGCAAACTGGACACCGTAA
>probe:Drosophila_2:1635318_at:182:55; Interrogation_Position=965; Antisense; ATGACGGCGTCTATGGGTCCTTCAA
>probe:Drosophila_2:1635318_at:509:193; Interrogation_Position=988; Antisense; AACTGCATTCTGTACGACCATCAAG

Paste this into a BLAST search page for me
TTTGCCACACCTAAAGTCCTTGATTGCCAAGTTGTGACGCCCTAGATAAGAAGATTTCGGAGGACCTGCACTTGCACCGAGGCGATCTTTTGGGATTCCGTGGGATTCCGAAACATGGGCGCCTAAAGACCCTGTACTTCCAAGCTATATTTCGGCGCACTACTGGGCTATGACAGGCTATGACATGGACTTTCTGGACAGGTTCCCTGGCAGCGATGACGTAAAGAATACCTCGGTGCAGCGTCATTTTTGGTTTGCAAGATCCACGCCAAGCGGAAGCTGGCAAACTGGACACCGTAAATGACGGCGTCTATGGGTCCTTCAAAACTGCATTCTGTACGACCATCAAG

Full Affymetrix probeset data:

Annotations for 1635318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720