FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635319_at:

>probe:Drosophila_2:1635319_at:267:145; Interrogation_Position=2373; Antisense; ACTGCGATCGCACGTACCAGATGAA
>probe:Drosophila_2:1635319_at:503:87; Interrogation_Position=2397; Antisense; AGTCGCGCCTGAACAATCATATTCG
>probe:Drosophila_2:1635319_at:256:443; Interrogation_Position=2423; Antisense; GATGTGCACATTAACGGCGACCGCA
>probe:Drosophila_2:1635319_at:331:547; Interrogation_Position=2455; Antisense; GGAGGCAATTAAGCGCTTCCTCTGC
>probe:Drosophila_2:1635319_at:588:641; Interrogation_Position=2475; Antisense; TCTGCTCCCTGTGCGGAATGGAGAC
>probe:Drosophila_2:1635319_at:165:229; Interrogation_Position=2491; Antisense; AATGGAGACGAGATCAGCCGCCGCT
>probe:Drosophila_2:1635319_at:150:25; Interrogation_Position=2526; Antisense; ATATGCGACGCCACACTGGCGAGAA
>probe:Drosophila_2:1635319_at:220:451; Interrogation_Position=2564; Antisense; GATCTGTGCGAAATGGCCTTTCCCC
>probe:Drosophila_2:1635319_at:491:337; Interrogation_Position=2673; Antisense; GCTCCGATAAGCTCAAGCGCCATAT
>probe:Drosophila_2:1635319_at:119:25; Interrogation_Position=2694; Antisense; ATATGCTTACGCACAGCGGCCTAAA
>probe:Drosophila_2:1635319_at:235:1; Interrogation_Position=2745; Antisense; AGAGTTACCGTCAGGCCAAGGACCT
>probe:Drosophila_2:1635319_at:624:369; Interrogation_Position=2798; Antisense; GAATGTCCTTTCGTGTGCGGCACCT
>probe:Drosophila_2:1635319_at:458:521; Interrogation_Position=2823; Antisense; GTGGCGAGCGCTTCATCCAGAGCAG
>probe:Drosophila_2:1635319_at:154:209; Interrogation_Position=2858; Antisense; AAGCATCGGTTGATGCGGCGTCACT

Paste this into a BLAST search page for me
ACTGCGATCGCACGTACCAGATGAAAGTCGCGCCTGAACAATCATATTCGGATGTGCACATTAACGGCGACCGCAGGAGGCAATTAAGCGCTTCCTCTGCTCTGCTCCCTGTGCGGAATGGAGACAATGGAGACGAGATCAGCCGCCGCTATATGCGACGCCACACTGGCGAGAAGATCTGTGCGAAATGGCCTTTCCCCGCTCCGATAAGCTCAAGCGCCATATATATGCTTACGCACAGCGGCCTAAAAGAGTTACCGTCAGGCCAAGGACCTGAATGTCCTTTCGTGTGCGGCACCTGTGGCGAGCGCTTCATCCAGAGCAGAAGCATCGGTTGATGCGGCGTCACT

Full Affymetrix probeset data:

Annotations for 1635319_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720