Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635321_at:

>probe:Drosophila_2:1635321_at:250:33; Interrogation_Position=337; Antisense; ATCACCTTTAGCAACCGAGTTCGGG
>probe:Drosophila_2:1635321_at:685:131; Interrogation_Position=350; Antisense; ACCGAGTTCGGGAGATCTGCTGGCA
>probe:Drosophila_2:1635321_at:204:203; Interrogation_Position=388; Antisense; AAGCCGGCCGTCTGTCAAAGTATGT
>probe:Drosophila_2:1635321_at:273:75; Interrogation_Position=458; Antisense; AGGACTCGTGGTTCCTGCACACGGA
>probe:Drosophila_2:1635321_at:571:539; Interrogation_Position=538; Antisense; GGTTGCCTGCAGTTCATCAAGGGAT
>probe:Drosophila_2:1635321_at:309:433; Interrogation_Position=570; Antisense; GAGTGGAGTCCACAGGCGCTACCTT
>probe:Drosophila_2:1635321_at:614:605; Interrogation_Position=623; Antisense; TGATGGTCTACGATCGGGCAGCTCC
>probe:Drosophila_2:1635321_at:107:117; Interrogation_Position=664; Antisense; AGCTTCACGCCAATGCAAGTCAGCA
>probe:Drosophila_2:1635321_at:593:361; Interrogation_Position=678; Antisense; GCAAGTCAGCAAGGGCACCTGCATT
>probe:Drosophila_2:1635321_at:406:353; Interrogation_Position=692; Antisense; GCACCTGCATTCTAATCCACGGAAA
>probe:Drosophila_2:1635321_at:19:369; Interrogation_Position=738; Antisense; GAATCGCTCGCAAAAGAGTCGCCAC
>probe:Drosophila_2:1635321_at:129:149; Interrogation_Position=769; Antisense; ACTTTCCACGTCATCGAGACTGAGA
>probe:Drosophila_2:1635321_at:157:371; Interrogation_Position=834; Antisense; GAAGGATAAGCCATTCCCTGTCCTC
>probe:Drosophila_2:1635321_at:144:599; Interrogation_Position=852; Antisense; TGTCCTCTTCGAACGCAAGGCCTAA

Paste this into a BLAST search page for me
ATCACCTTTAGCAACCGAGTTCGGGACCGAGTTCGGGAGATCTGCTGGCAAAGCCGGCCGTCTGTCAAAGTATGTAGGACTCGTGGTTCCTGCACACGGAGGTTGCCTGCAGTTCATCAAGGGATGAGTGGAGTCCACAGGCGCTACCTTTGATGGTCTACGATCGGGCAGCTCCAGCTTCACGCCAATGCAAGTCAGCAGCAAGTCAGCAAGGGCACCTGCATTGCACCTGCATTCTAATCCACGGAAAGAATCGCTCGCAAAAGAGTCGCCACACTTTCCACGTCATCGAGACTGAGAGAAGGATAAGCCATTCCCTGTCCTCTGTCCTCTTCGAACGCAAGGCCTAA

Full Affymetrix probeset data:

Annotations for 1635321_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime