FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635327_at:

>probe:Drosophila_2:1635327_at:168:263; Interrogation_Position=139; Antisense; CAGCGGAGTGCGGTTACCCGGAATT
>probe:Drosophila_2:1635327_at:694:31; Interrogation_Position=233; Antisense; ATAATAGCCACGACCAGTAGTCCTC
>probe:Drosophila_2:1635327_at:129:369; Interrogation_Position=307; Antisense; GAATCCGTCCAGGTTTCAAGGGAAT
>probe:Drosophila_2:1635327_at:7:369; Interrogation_Position=328; Antisense; GAATGCATCAACAGCTCACGATCGA
>probe:Drosophila_2:1635327_at:497:683; Interrogation_Position=374; Antisense; TATGCTCATAATGTGCAGGCCCCAT
>probe:Drosophila_2:1635327_at:615:235; Interrogation_Position=401; Antisense; AATCCGCACCCGGTCATAATGGGTC
>probe:Drosophila_2:1635327_at:628:27; Interrogation_Position=416; Antisense; ATAATGGGTCCGTCCAGGTTTCATG
>probe:Drosophila_2:1635327_at:690:59; Interrogation_Position=438; Antisense; ATGGAAATCTACCACCTATTCAGGA
>probe:Drosophila_2:1635327_at:308:485; Interrogation_Position=477; Antisense; GTAGTCCCCGAGATCAAGGATTTCA
>probe:Drosophila_2:1635327_at:562:617; Interrogation_Position=516; Antisense; TGCATAGAGGCTGTGGTGACCACTA
>probe:Drosophila_2:1635327_at:120:535; Interrogation_Position=530; Antisense; GGTGACCACTATAGTTATTCGGCAA
>probe:Drosophila_2:1635327_at:550:361; Interrogation_Position=630; Antisense; GCAATACTCAGCACTATCAGAATCT
>probe:Drosophila_2:1635327_at:584:641; Interrogation_Position=652; Antisense; TCTGAATTTTTATCATCCACCTCCA
>probe:Drosophila_2:1635327_at:448:587; Interrogation_Position=679; Antisense; TGGACCCAGATTTCCCTGGCTTTAG

Paste this into a BLAST search page for me
CAGCGGAGTGCGGTTACCCGGAATTATAATAGCCACGACCAGTAGTCCTCGAATCCGTCCAGGTTTCAAGGGAATGAATGCATCAACAGCTCACGATCGATATGCTCATAATGTGCAGGCCCCATAATCCGCACCCGGTCATAATGGGTCATAATGGGTCCGTCCAGGTTTCATGATGGAAATCTACCACCTATTCAGGAGTAGTCCCCGAGATCAAGGATTTCATGCATAGAGGCTGTGGTGACCACTAGGTGACCACTATAGTTATTCGGCAAGCAATACTCAGCACTATCAGAATCTTCTGAATTTTTATCATCCACCTCCATGGACCCAGATTTCCCTGGCTTTAG

Full Affymetrix probeset data:

Annotations for 1635327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720