FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635328_at:

>probe:Drosophila_2:1635328_at:59:257; Interrogation_Position=2833; Antisense; CACAAGACCATATCCGGATGCTCGG
>probe:Drosophila_2:1635328_at:19:435; Interrogation_Position=2866; Antisense; GAGGGCGTGGACTTCAGCTGACTAA
>probe:Drosophila_2:1635328_at:377:369; Interrogation_Position=2947; Antisense; GAATGCTCCGCATCCGTGTCGGGAT
>probe:Drosophila_2:1635328_at:226:219; Interrogation_Position=3004; Antisense; AAGGGACGCGTCCTCTAATGCATTT
>probe:Drosophila_2:1635328_at:247:233; Interrogation_Position=3020; Antisense; AATGCATTTTGCTCTTTTGATACTT
>probe:Drosophila_2:1635328_at:178:605; Interrogation_Position=3037; Antisense; TGATACTTTTGTAAGCTCCGCCAGA
>probe:Drosophila_2:1635328_at:466:85; Interrogation_Position=3077; Antisense; AGTGCATCCCACTTCTCAAAACTGT
>probe:Drosophila_2:1635328_at:11:179; Interrogation_Position=3095; Antisense; AAACTGTCAGTATTCGCATTGAACG
>probe:Drosophila_2:1635328_at:452:675; Interrogation_Position=3159; Antisense; TAGACCTAAGGCTACGTTTAACTAT
>probe:Drosophila_2:1635328_at:701:89; Interrogation_Position=3186; Antisense; AGTACTATACCTACCACATGAGATA
>probe:Drosophila_2:1635328_at:299:351; Interrogation_Position=3253; Antisense; GCAGACCATTGTTTTCAGTTCCGAT
>probe:Drosophila_2:1635328_at:31:503; Interrogation_Position=3296; Antisense; GTCGCTGAGGACACTCATTCGCATA
>probe:Drosophila_2:1635328_at:118:601; Interrogation_Position=3355; Antisense; TGTATGTGTGTATCGCAGCAGGGTA
>probe:Drosophila_2:1635328_at:654:77; Interrogation_Position=3374; Antisense; AGGGTAAGTTGGCTGCGTTTTCAAT

Paste this into a BLAST search page for me
CACAAGACCATATCCGGATGCTCGGGAGGGCGTGGACTTCAGCTGACTAAGAATGCTCCGCATCCGTGTCGGGATAAGGGACGCGTCCTCTAATGCATTTAATGCATTTTGCTCTTTTGATACTTTGATACTTTTGTAAGCTCCGCCAGAAGTGCATCCCACTTCTCAAAACTGTAAACTGTCAGTATTCGCATTGAACGTAGACCTAAGGCTACGTTTAACTATAGTACTATACCTACCACATGAGATAGCAGACCATTGTTTTCAGTTCCGATGTCGCTGAGGACACTCATTCGCATATGTATGTGTGTATCGCAGCAGGGTAAGGGTAAGTTGGCTGCGTTTTCAAT

Full Affymetrix probeset data:

Annotations for 1635328_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720