FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635329_at:

>probe:Drosophila_2:1635329_at:109:49; Interrogation_Position=1322; Antisense; ATCCTATGCCTTTATCTCACACTTA
>probe:Drosophila_2:1635329_at:406:81; Interrogation_Position=1370; Antisense; AGCTGGTCGGGTATTTTCCGCGAGA
>probe:Drosophila_2:1635329_at:706:101; Interrogation_Position=1392; Antisense; AGAGCGTTGTCCTGCAGCACGAGTG
>probe:Drosophila_2:1635329_at:97:225; Interrogation_Position=1434; Antisense; AAGGAGCTGGTGTTGCCGTTTCCCA
>probe:Drosophila_2:1635329_at:143:19; Interrogation_Position=1476; Antisense; ATATTATTGAGTCGGCGCAATCGCT
>probe:Drosophila_2:1635329_at:220:237; Interrogation_Position=1494; Antisense; AATCGCTGCAGGCTTCGTTTAGCAG
>probe:Drosophila_2:1635329_at:358:599; Interrogation_Position=1545; Antisense; TGTACAAGGGTTTCCTGGGCTTTGC
>probe:Drosophila_2:1635329_at:180:689; Interrogation_Position=1593; Antisense; TATTCGCCACTTCATCGCTGGGCAT
>probe:Drosophila_2:1635329_at:410:297; Interrogation_Position=1608; Antisense; CGCTGGGCATTGTCTACCAATCATA
>probe:Drosophila_2:1635329_at:376:165; Interrogation_Position=1657; Antisense; AAATCCCCGTCGTAGTATATGACTT
>probe:Drosophila_2:1635329_at:670:83; Interrogation_Position=1693; Antisense; AGTGAATTTATACCGCACACGAAAT
>probe:Drosophila_2:1635329_at:535:21; Interrogation_Position=1720; Antisense; ATATTAGTTTCTACTCATGTGGCGA
>probe:Drosophila_2:1635329_at:449:661; Interrogation_Position=1810; Antisense; TAAAGACTTTTAACCAGGCTGCCCG
>probe:Drosophila_2:1635329_at:59:23; Interrogation_Position=1825; Antisense; AGGCTGCCCGGAGAGTAACCAAAGT

Paste this into a BLAST search page for me
ATCCTATGCCTTTATCTCACACTTAAGCTGGTCGGGTATTTTCCGCGAGAAGAGCGTTGTCCTGCAGCACGAGTGAAGGAGCTGGTGTTGCCGTTTCCCAATATTATTGAGTCGGCGCAATCGCTAATCGCTGCAGGCTTCGTTTAGCAGTGTACAAGGGTTTCCTGGGCTTTGCTATTCGCCACTTCATCGCTGGGCATCGCTGGGCATTGTCTACCAATCATAAAATCCCCGTCGTAGTATATGACTTAGTGAATTTATACCGCACACGAAATATATTAGTTTCTACTCATGTGGCGATAAAGACTTTTAACCAGGCTGCCCGAGGCTGCCCGGAGAGTAACCAAAGT

Full Affymetrix probeset data:

Annotations for 1635329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720