FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635330_at:

>probe:Drosophila_2:1635330_at:64:527; Interrogation_Position=1018; Antisense; GGGAATTCGATCTCTGGTCCGATAG
>probe:Drosophila_2:1635330_at:280:493; Interrogation_Position=1042; Antisense; GTAATCTGCGGGACTTCAAATTGAA
>probe:Drosophila_2:1635330_at:592:545; Interrogation_Position=1070; Antisense; GGATGACTTTGCCAACTACAGCAAG
>probe:Drosophila_2:1635330_at:291:689; Interrogation_Position=1095; Antisense; TTTGCGTCCACGTAATTCTCTCTAA
>probe:Drosophila_2:1635330_at:375:711; Interrogation_Position=1110; Antisense; TTCTCTCTAATTGTCTTCGCTAAAG
>probe:Drosophila_2:1635330_at:241:669; Interrogation_Position=633; Antisense; TACCAGGGCACCAAGTCGGACTTTA
>probe:Drosophila_2:1635330_at:361:219; Interrogation_Position=645; Antisense; AAGTCGGACTTTATGCACTCCTTCA
>probe:Drosophila_2:1635330_at:191:43; Interrogation_Position=669; Antisense; ATCGACGGCTATGTGAACTTCACGC
>probe:Drosophila_2:1635330_at:522:645; Interrogation_Position=748; Antisense; TCTTCACCAGCTACGAGCGGATGAA
>probe:Drosophila_2:1635330_at:437:309; Interrogation_Position=776; Antisense; CCAGCTGGGCCAGGTTATCTCGGAG
>probe:Drosophila_2:1635330_at:710:123; Interrogation_Position=817; Antisense; AGCGCAGTGTCAGCCAGGAGCAGAT
>probe:Drosophila_2:1635330_at:258:279; Interrogation_Position=891; Antisense; GCCTGCAACCACGTCAAGGAGTTCG
>probe:Drosophila_2:1635330_at:473:85; Interrogation_Position=952; Antisense; AGTTCAGGTTCGTTCGACGCGGAGT
>probe:Drosophila_2:1635330_at:639:159; Interrogation_Position=988; Antisense; ACAAGGATGAGCTCACCGCCGACAT

Paste this into a BLAST search page for me
GGGAATTCGATCTCTGGTCCGATAGGTAATCTGCGGGACTTCAAATTGAAGGATGACTTTGCCAACTACAGCAAGTTTGCGTCCACGTAATTCTCTCTAATTCTCTCTAATTGTCTTCGCTAAAGTACCAGGGCACCAAGTCGGACTTTAAAGTCGGACTTTATGCACTCCTTCAATCGACGGCTATGTGAACTTCACGCTCTTCACCAGCTACGAGCGGATGAACCAGCTGGGCCAGGTTATCTCGGAGAGCGCAGTGTCAGCCAGGAGCAGATGCCTGCAACCACGTCAAGGAGTTCGAGTTCAGGTTCGTTCGACGCGGAGTACAAGGATGAGCTCACCGCCGACAT

Full Affymetrix probeset data:

Annotations for 1635330_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720