FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635331_at:

>probe:Drosophila_2:1635331_at:609:99; Interrogation_Position=138; Antisense; AGATGGCTCGAAGGCCACTCAGGAT
>probe:Drosophila_2:1635331_at:611:611; Interrogation_Position=14; Antisense; TGAAGTACCTAATGTTAATTGCCCT
>probe:Drosophila_2:1635331_at:441:373; Interrogation_Position=171; Antisense; GAAGTCCGTGAATGCCGATCACAAC
>probe:Drosophila_2:1635331_at:302:227; Interrogation_Position=208; Antisense; AATGGAAAGTACTCCTTCGTCGCCG
>probe:Drosophila_2:1635331_at:442:637; Interrogation_Position=224; Antisense; TCGTCGCCGACGATGGAAAGACCTA
>probe:Drosophila_2:1635331_at:639:681; Interrogation_Position=247; Antisense; TATGTTGTGTCCTACACGGCGGACG
>probe:Drosophila_2:1635331_at:709:541; Interrogation_Position=277; Antisense; GGATACCTTGCGGTGGGTGACCACC
>probe:Drosophila_2:1635331_at:224:653; Interrogation_Position=29; Antisense; TAATTGCCCTTTTTGTGGTCGCTGC
>probe:Drosophila_2:1635331_at:547:289; Interrogation_Position=323; Antisense; CGGTGTCCGTTCTGAAGGCTCTGGA
>probe:Drosophila_2:1635331_at:320:371; Interrogation_Position=336; Antisense; GAAGGCTCTGGAGTACATCCGCCTG
>probe:Drosophila_2:1635331_at:463:615; Interrogation_Position=359; Antisense; TGCATCCGTACAAGACGCCCGAGCA
>probe:Drosophila_2:1635331_at:243:327; Interrogation_Position=49; Antisense; GCTGCTTCGGCGACGGACAACGATG
>probe:Drosophila_2:1635331_at:140:397; Interrogation_Position=64; Antisense; GACAACGATGATCCGATTTCCCAGG
>probe:Drosophila_2:1635331_at:518:459; Interrogation_Position=78; Antisense; GATTTCCCAGGAATCCAATGTGGAG

Paste this into a BLAST search page for me
AGATGGCTCGAAGGCCACTCAGGATTGAAGTACCTAATGTTAATTGCCCTGAAGTCCGTGAATGCCGATCACAACAATGGAAAGTACTCCTTCGTCGCCGTCGTCGCCGACGATGGAAAGACCTATATGTTGTGTCCTACACGGCGGACGGGATACCTTGCGGTGGGTGACCACCTAATTGCCCTTTTTGTGGTCGCTGCCGGTGTCCGTTCTGAAGGCTCTGGAGAAGGCTCTGGAGTACATCCGCCTGTGCATCCGTACAAGACGCCCGAGCAGCTGCTTCGGCGACGGACAACGATGGACAACGATGATCCGATTTCCCAGGGATTTCCCAGGAATCCAATGTGGAG

Full Affymetrix probeset data:

Annotations for 1635331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720