FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635335_at:

>probe:Drosophila_2:1635335_at:144:111; Interrogation_Position=1022; Antisense; AGAATGTATCGGATCTGTTGCGCAG
>probe:Drosophila_2:1635335_at:399:329; Interrogation_Position=1129; Antisense; GCGTGCTACCCGTACATCGAAAGTG
>probe:Drosophila_2:1635335_at:587:43; Interrogation_Position=1144; Antisense; ATCGAAAGTGATCCCTTCATCCTGC
>probe:Drosophila_2:1635335_at:666:133; Interrogation_Position=1226; Antisense; ACGAGGGTTCCGAAGGCAAGCGCAC
>probe:Drosophila_2:1635335_at:618:499; Interrogation_Position=1258; Antisense; GTCTGCGTGCCCAGTTTTAGCAAAA
>probe:Drosophila_2:1635335_at:658:185; Interrogation_Position=1281; Antisense; AACACAGAGTGTGGCCGTCGTTGAC
>probe:Drosophila_2:1635335_at:68:469; Interrogation_Position=1300; Antisense; GTTGACCTGGATACGCTGGATTGCC
>probe:Drosophila_2:1635335_at:577:541; Interrogation_Position=1317; Antisense; GGATTGCCGCATGGTCAACTTTAGC
>probe:Drosophila_2:1635335_at:174:239; Interrogation_Position=1377; Antisense; AATACACCCTGTTAAGTCTTGAGAA
>probe:Drosophila_2:1635335_at:463:97; Interrogation_Position=819; Antisense; AGACCAGTGGTTTGCCTCATGGGCA
>probe:Drosophila_2:1635335_at:488:353; Interrogation_Position=906; Antisense; GCAGCCGTTCCACAAGTGCATGTTT
>probe:Drosophila_2:1635335_at:150:567; Interrogation_Position=948; Antisense; GGCAACTTTCCAGGCGGTGACTAAT
>probe:Drosophila_2:1635335_at:709:531; Interrogation_Position=963; Antisense; GGTGACTAATCCGTACAGCTGCCGG
>probe:Drosophila_2:1635335_at:610:51; Interrogation_Position=992; Antisense; ATGAGGCCCTGGTGGTAGGCACATC

Paste this into a BLAST search page for me
AGAATGTATCGGATCTGTTGCGCAGGCGTGCTACCCGTACATCGAAAGTGATCGAAAGTGATCCCTTCATCCTGCACGAGGGTTCCGAAGGCAAGCGCACGTCTGCGTGCCCAGTTTTAGCAAAAAACACAGAGTGTGGCCGTCGTTGACGTTGACCTGGATACGCTGGATTGCCGGATTGCCGCATGGTCAACTTTAGCAATACACCCTGTTAAGTCTTGAGAAAGACCAGTGGTTTGCCTCATGGGCAGCAGCCGTTCCACAAGTGCATGTTTGGCAACTTTCCAGGCGGTGACTAATGGTGACTAATCCGTACAGCTGCCGGATGAGGCCCTGGTGGTAGGCACATC

Full Affymetrix probeset data:

Annotations for 1635335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720