FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635336_at:

>probe:Drosophila_2:1635336_at:618:151; Interrogation_Position=1059; Antisense; ACATCTGCAACATTGGCAGCTTCGC
>probe:Drosophila_2:1635336_at:284:507; Interrogation_Position=1088; Antisense; GTGCGAGTCGATTAAGCCAAACTTT
>probe:Drosophila_2:1635336_at:370:597; Interrogation_Position=1112; Antisense; TGTGATGATGCCAATTGTGCCCAGT
>probe:Drosophila_2:1635336_at:718:595; Interrogation_Position=1127; Antisense; TGTGCCCAGTTATGCGGAGGTATTC
>probe:Drosophila_2:1635336_at:392:547; Interrogation_Position=1142; Antisense; GGAGGTATTCGGCAGCTCGTACAAA
>probe:Drosophila_2:1635336_at:316:567; Interrogation_Position=1152; Antisense; GGCAGCTCGTACAAAACCGTCGACG
>probe:Drosophila_2:1635336_at:84:365; Interrogation_Position=1254; Antisense; GAATACGAATACCTAGCCAAGCAAC
>probe:Drosophila_2:1635336_at:592:673; Interrogation_Position=1267; Antisense; TAGCCAAGCAACTGAGCTCTGTGAT
>probe:Drosophila_2:1635336_at:348:419; Interrogation_Position=1280; Antisense; GAGCTCTGTGATATTTTCATGTTCA
>probe:Drosophila_2:1635336_at:333:473; Interrogation_Position=1300; Antisense; GTTCATGCTGGAAAGACATACCCAT
>probe:Drosophila_2:1635336_at:44:193; Interrogation_Position=1364; Antisense; AACTAAACATACTACTCGCTACTAA
>probe:Drosophila_2:1635336_at:533:675; Interrogation_Position=1395; Antisense; TAGCTGAATAGTTTCGCCACATTGT
>probe:Drosophila_2:1635336_at:109:107; Interrogation_Position=952; Antisense; AGACACCTTCGTTTTGTGATGCCAC
>probe:Drosophila_2:1635336_at:219:729; Interrogation_Position=965; Antisense; TTGTGATGCCACAATGCCGCTGCTC

Paste this into a BLAST search page for me
ACATCTGCAACATTGGCAGCTTCGCGTGCGAGTCGATTAAGCCAAACTTTTGTGATGATGCCAATTGTGCCCAGTTGTGCCCAGTTATGCGGAGGTATTCGGAGGTATTCGGCAGCTCGTACAAAGGCAGCTCGTACAAAACCGTCGACGGAATACGAATACCTAGCCAAGCAACTAGCCAAGCAACTGAGCTCTGTGATGAGCTCTGTGATATTTTCATGTTCAGTTCATGCTGGAAAGACATACCCATAACTAAACATACTACTCGCTACTAATAGCTGAATAGTTTCGCCACATTGTAGACACCTTCGTTTTGTGATGCCACTTGTGATGCCACAATGCCGCTGCTC

Full Affymetrix probeset data:

Annotations for 1635336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720