Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635338_a_at:

>probe:Drosophila_2:1635338_a_at:594:411; Interrogation_Position=114; Antisense; GACCACGGCCCGAATCGAGAACCAG
>probe:Drosophila_2:1635338_a_at:687:125; Interrogation_Position=155; Antisense; ACCAGCAGGGTCAGCATGGACACCA
>probe:Drosophila_2:1635338_a_at:97:381; Interrogation_Position=17; Antisense; GAACCAGCCAGCTCAGTAGCAGCTT
>probe:Drosophila_2:1635338_a_at:559:585; Interrogation_Position=171; Antisense; TGGACACCACCAACAGGGCCAGGGT
>probe:Drosophila_2:1635338_a_at:249:267; Interrogation_Position=190; Antisense; CAGGGTCAAAGCCAGTACAGCGCAG
>probe:Drosophila_2:1635338_a_at:121:29; Interrogation_Position=240; Antisense; ATACGAGGACGCCAGTCGCTACATC
>probe:Drosophila_2:1635338_a_at:340:279; Interrogation_Position=258; Antisense; CTACATCGGCGAGTGGAACCAGCGT
>probe:Drosophila_2:1635338_a_at:606:519; Interrogation_Position=270; Antisense; GTGGAACCAGCGTGGCCAAAAGCAC
>probe:Drosophila_2:1635338_a_at:595:183; Interrogation_Position=287; Antisense; AAAAGCACGGCATCGGGCATCTGCA
>probe:Drosophila_2:1635338_a_at:112:525; Interrogation_Position=301; Antisense; GGGCATCTGCAGTTCGCCGATGGCA
>probe:Drosophila_2:1635338_a_at:429:67; Interrogation_Position=320; Antisense; ATGGCACCCGCTACGATGGGCAGTT
>probe:Drosophila_2:1635338_a_at:694:347; Interrogation_Position=339; Antisense; GCAGTTCCAGGAGGGTCTTAGTCAA
>probe:Drosophila_2:1635338_a_at:391:685; Interrogation_Position=356; Antisense; TTAGTCAAGGAGTGGGCTGCCTCTG
>probe:Drosophila_2:1635338_a_at:519:111; Interrogation_Position=66; Antisense; AGCAATGGCCATGGACGACTACGAT

Paste this into a BLAST search page for me
GACCACGGCCCGAATCGAGAACCAGACCAGCAGGGTCAGCATGGACACCAGAACCAGCCAGCTCAGTAGCAGCTTTGGACACCACCAACAGGGCCAGGGTCAGGGTCAAAGCCAGTACAGCGCAGATACGAGGACGCCAGTCGCTACATCCTACATCGGCGAGTGGAACCAGCGTGTGGAACCAGCGTGGCCAAAAGCACAAAAGCACGGCATCGGGCATCTGCAGGGCATCTGCAGTTCGCCGATGGCAATGGCACCCGCTACGATGGGCAGTTGCAGTTCCAGGAGGGTCTTAGTCAATTAGTCAAGGAGTGGGCTGCCTCTGAGCAATGGCCATGGACGACTACGAT

Full Affymetrix probeset data:

Annotations for 1635338_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime