Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635339_at:

>probe:Drosophila_2:1635339_at:471:239; Interrogation_Position=1717; Antisense; AATCAGGAGCTCTACGTATGCGTCT
>probe:Drosophila_2:1635339_at:423:347; Interrogation_Position=1782; Antisense; GCATGCCAAGCGACATTTGAACCCA
>probe:Drosophila_2:1635339_at:510:683; Interrogation_Position=1797; Antisense; TTTGAACCCATTGACTTTGACCACC
>probe:Drosophila_2:1635339_at:382:177; Interrogation_Position=1831; Antisense; AAACTGCTGATGGAATCTGCCGCTT
>probe:Drosophila_2:1635339_at:263:397; Interrogation_Position=1879; Antisense; GACAATCCATCATCGGTGGGTCAGA
>probe:Drosophila_2:1635339_at:367:519; Interrogation_Position=1904; Antisense; GTGGTGCAAACAATTCGAGCGGTTC
>probe:Drosophila_2:1635339_at:113:295; Interrogation_Position=1919; Antisense; CGAGCGGTTCGATTGCAACTGGTAA
>probe:Drosophila_2:1635339_at:214:189; Interrogation_Position=1968; Antisense; AACAGCCTTGCTGCGACGTGAGGTT
>probe:Drosophila_2:1635339_at:459:139; Interrogation_Position=1983; Antisense; ACGTGAGGTTCGACCGCTGGACATG
>probe:Drosophila_2:1635339_at:371:21; Interrogation_Position=2016; Antisense; ATATTATCCCTGCAAGACGTGTGGC
>probe:Drosophila_2:1635339_at:405:407; Interrogation_Position=2031; Antisense; GACGTGTGGCAGCAAGTTTCCCAGC
>probe:Drosophila_2:1635339_at:75:479; Interrogation_Position=2046; Antisense; GTTTCCCAGCTACTATTTTGTGCAC
>probe:Drosophila_2:1635339_at:555:437; Interrogation_Position=2104; Antisense; GAGGCGACGGCCACTAGCAATACGA
>probe:Drosophila_2:1635339_at:486:325; Interrogation_Position=2209; Antisense; GCGAAACGCGACGATCAGCAGCAAC

Paste this into a BLAST search page for me
AATCAGGAGCTCTACGTATGCGTCTGCATGCCAAGCGACATTTGAACCCATTTGAACCCATTGACTTTGACCACCAAACTGCTGATGGAATCTGCCGCTTGACAATCCATCATCGGTGGGTCAGAGTGGTGCAAACAATTCGAGCGGTTCCGAGCGGTTCGATTGCAACTGGTAAAACAGCCTTGCTGCGACGTGAGGTTACGTGAGGTTCGACCGCTGGACATGATATTATCCCTGCAAGACGTGTGGCGACGTGTGGCAGCAAGTTTCCCAGCGTTTCCCAGCTACTATTTTGTGCACGAGGCGACGGCCACTAGCAATACGAGCGAAACGCGACGATCAGCAGCAAC

Full Affymetrix probeset data:

Annotations for 1635339_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime