FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635340_at:

>probe:Drosophila_2:1635340_at:529:683; Interrogation_Position=7625; Antisense; TATCGCGCCCAAATTCGCAAGGTTT
>probe:Drosophila_2:1635340_at:357:507; Interrogation_Position=7663; Antisense; GTGCGAGGTGCATTTTATTGACTTT
>probe:Drosophila_2:1635340_at:239:359; Interrogation_Position=7689; Antisense; GCAACAATGCCGTGACGCAGCAGTT
>probe:Drosophila_2:1635340_at:141:205; Interrogation_Position=7739; Antisense; AAGCCGGCGCGATACAGCAGGCATT
>probe:Drosophila_2:1635340_at:412:447; Interrogation_Position=7772; Antisense; GATGCGTCGACCATATCCAAGTGCG
>probe:Drosophila_2:1635340_at:592:145; Interrogation_Position=7826; Antisense; ACTCGCTTCTCTGAAACATTCCAGG
>probe:Drosophila_2:1635340_at:115:377; Interrogation_Position=7853; Antisense; GAGATTCTGGCCACCAAGGGAACTG
>probe:Drosophila_2:1635340_at:62:221; Interrogation_Position=7868; Antisense; AAGGGAACTGGCACCCATGTCGTAC
>probe:Drosophila_2:1635340_at:248:61; Interrogation_Position=7884; Antisense; ATGTCGTACGACTCTTCTACCAGAG
>probe:Drosophila_2:1635340_at:354:73; Interrogation_Position=7932; Antisense; AGGAATGTCAGTGATCACCCCGTTG
>probe:Drosophila_2:1635340_at:71:605; Interrogation_Position=7943; Antisense; TGATCACCCCGTTGTACAGTCAGAT
>probe:Drosophila_2:1635340_at:501:41; Interrogation_Position=7966; Antisense; ATCGGACTCATATGTGCTCCATGCA
>probe:Drosophila_2:1635340_at:130:549; Interrogation_Position=8072; Antisense; GGAGGACACCACACGATTAGCCAAG
>probe:Drosophila_2:1635340_at:84:447; Interrogation_Position=8096; Antisense; GATGCTTCATTGACTTTTCATGGAA

Paste this into a BLAST search page for me
TATCGCGCCCAAATTCGCAAGGTTTGTGCGAGGTGCATTTTATTGACTTTGCAACAATGCCGTGACGCAGCAGTTAAGCCGGCGCGATACAGCAGGCATTGATGCGTCGACCATATCCAAGTGCGACTCGCTTCTCTGAAACATTCCAGGGAGATTCTGGCCACCAAGGGAACTGAAGGGAACTGGCACCCATGTCGTACATGTCGTACGACTCTTCTACCAGAGAGGAATGTCAGTGATCACCCCGTTGTGATCACCCCGTTGTACAGTCAGATATCGGACTCATATGTGCTCCATGCAGGAGGACACCACACGATTAGCCAAGGATGCTTCATTGACTTTTCATGGAA

Full Affymetrix probeset data:

Annotations for 1635340_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720