FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635341_at:

>probe:Drosophila_2:1635341_at:175:409; Interrogation_Position=409; Antisense; GACGTGGAGTCGATCACATCGCATA
>probe:Drosophila_2:1635341_at:553:55; Interrogation_Position=434; Antisense; ATGACTACGATCCAGCCAATTACAC
>probe:Drosophila_2:1635341_at:594:309; Interrogation_Position=448; Antisense; GCCAATTACACCTTTCGGAACGACA
>probe:Drosophila_2:1635341_at:624:439; Interrogation_Position=510; Antisense; GATGGCTTACTATCCGATTTGCGTT
>probe:Drosophila_2:1635341_at:157:19; Interrogation_Position=526; Antisense; ATTTGCGTTCTGGACTACCCAAGGT
>probe:Drosophila_2:1635341_at:34:183; Interrogation_Position=589; Antisense; AAAACGGGCATGTTCGACACTGGGA
>probe:Drosophila_2:1635341_at:434:223; Interrogation_Position=616; Antisense; AAGGTGCTGAAACACGCTGCCGTCA
>probe:Drosophila_2:1635341_at:245:183; Interrogation_Position=668; Antisense; AAAAGTACGCACACCGGCATTTCGG
>probe:Drosophila_2:1635341_at:127:19; Interrogation_Position=686; Antisense; ATTTCGGGCCCAGATTCCAGATATG
>probe:Drosophila_2:1635341_at:457:405; Interrogation_Position=748; Antisense; GACTCCGGCAGTCCATTGATGGGCA
>probe:Drosophila_2:1635341_at:510:151; Interrogation_Position=772; Antisense; ACATCGGGTCGCAGCTACGAGACAA
>probe:Drosophila_2:1635341_at:199:669; Interrogation_Position=787; Antisense; TACGAGACAATCACGTTCCTGGCCG
>probe:Drosophila_2:1635341_at:501:345; Interrogation_Position=812; Antisense; GCATCACTTCATACGGAGGTCCTTG
>probe:Drosophila_2:1635341_at:105:3; Interrogation_Position=844; Antisense; ATTGGCTGGCCGAGTGTTTTCACAC

Paste this into a BLAST search page for me
GACGTGGAGTCGATCACATCGCATAATGACTACGATCCAGCCAATTACACGCCAATTACACCTTTCGGAACGACAGATGGCTTACTATCCGATTTGCGTTATTTGCGTTCTGGACTACCCAAGGTAAAACGGGCATGTTCGACACTGGGAAAGGTGCTGAAACACGCTGCCGTCAAAAAGTACGCACACCGGCATTTCGGATTTCGGGCCCAGATTCCAGATATGGACTCCGGCAGTCCATTGATGGGCAACATCGGGTCGCAGCTACGAGACAATACGAGACAATCACGTTCCTGGCCGGCATCACTTCATACGGAGGTCCTTGATTGGCTGGCCGAGTGTTTTCACAC

Full Affymetrix probeset data:

Annotations for 1635341_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720