Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635342_at:

>probe:Drosophila_2:1635342_at:692:619; Interrogation_Position=309; Antisense; TGCTGAACTTCGACATCACGTACAC
>probe:Drosophila_2:1635342_at:212:491; Interrogation_Position=328; Antisense; GTACACCATTCTGCTGAAGTCACTG
>probe:Drosophila_2:1635342_at:464:141; Interrogation_Position=368; Antisense; ACGGATTTCGTGATGGCCAAGTGCC
>probe:Drosophila_2:1635342_at:317:63; Interrogation_Position=423; Antisense; ATGTGCAGACAATCATCGACCTCGC
>probe:Drosophila_2:1635342_at:218:293; Interrogation_Position=448; Antisense; CGACATACTGGAGCGGGCGGACTTC
>probe:Drosophila_2:1635342_at:278:523; Interrogation_Position=489; Antisense; GGGCCGAGGTGAACCGCAACATGTT
>probe:Drosophila_2:1635342_at:221:571; Interrogation_Position=527; Antisense; GGCTTCCACGATTCAATTCGCAAGT
>probe:Drosophila_2:1635342_at:151:533; Interrogation_Position=565; Antisense; GGTGGGCACCACATTCCAGACAATT
>probe:Drosophila_2:1635342_at:571:413; Interrogation_Position=596; Antisense; GACCTGCTTAAGGAGCTGCTCGGCG
>probe:Drosophila_2:1635342_at:69:109; Interrogation_Position=669; Antisense; AGAACCAGGGCCAGGGACTCGTCAT
>probe:Drosophila_2:1635342_at:295:523; Interrogation_Position=695; Antisense; GTGGCCATGCAGGACGACAAAATCA
>probe:Drosophila_2:1635342_at:242:429; Interrogation_Position=746; Antisense; GAGTTCGACAACGTGGGCGCCCTGA
>probe:Drosophila_2:1635342_at:112:87; Interrogation_Position=777; Antisense; AGTGCCTGTAGGAACCTCATTCGCG
>probe:Drosophila_2:1635342_at:716:9; Interrogation_Position=795; Antisense; ATTCGCGTTCATAGTCCTTGTCTAA

Paste this into a BLAST search page for me
TGCTGAACTTCGACATCACGTACACGTACACCATTCTGCTGAAGTCACTGACGGATTTCGTGATGGCCAAGTGCCATGTGCAGACAATCATCGACCTCGCCGACATACTGGAGCGGGCGGACTTCGGGCCGAGGTGAACCGCAACATGTTGGCTTCCACGATTCAATTCGCAAGTGGTGGGCACCACATTCCAGACAATTGACCTGCTTAAGGAGCTGCTCGGCGAGAACCAGGGCCAGGGACTCGTCATGTGGCCATGCAGGACGACAAAATCAGAGTTCGACAACGTGGGCGCCCTGAAGTGCCTGTAGGAACCTCATTCGCGATTCGCGTTCATAGTCCTTGTCTAA

Full Affymetrix probeset data:

Annotations for 1635342_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime