FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635344_at:

>probe:Drosophila_2:1635344_at:640:325; Interrogation_Position=1229; Antisense; GCGAGAACACTGTGCTTACCGTGAT
>probe:Drosophila_2:1635344_at:243:65; Interrogation_Position=1255; Antisense; ATGGGTGGCCATTGGTTCGACCAGT
>probe:Drosophila_2:1635344_at:4:129; Interrogation_Position=1274; Antisense; ACCAGTGGTTCGGTGATCGTCCAAG
>probe:Drosophila_2:1635344_at:635:113; Interrogation_Position=1304; Antisense; AGCAGATTCTTGACTTAGCCACCAG
>probe:Drosophila_2:1635344_at:84:285; Interrogation_Position=1345; Antisense; CTGCAGATACGCGAGGAACCCAAAT
>probe:Drosophila_2:1635344_at:146:247; Interrogation_Position=1367; Antisense; AATTCAGTCGAGTGCACACGCTGCA
>probe:Drosophila_2:1635344_at:518:219; Interrogation_Position=1393; Antisense; AAGTGCATCCCGCAGTACACTGTGG
>probe:Drosophila_2:1635344_at:395:317; Interrogation_Position=1428; Antisense; GCGCGTTGAAGCCATTCGGAACTAC
>probe:Drosophila_2:1635344_at:532:143; Interrogation_Position=1473; Antisense; ACTGTCTGTCTGTGGAGCTGCATAC
>probe:Drosophila_2:1635344_at:540:569; Interrogation_Position=1507; Antisense; GGCATCAACGATGTTATCCTATCCG
>probe:Drosophila_2:1635344_at:581:221; Interrogation_Position=1541; Antisense; AAGTGGAAGCCATACCCTTGTCCTA
>probe:Drosophila_2:1635344_at:658:243; Interrogation_Position=1668; Antisense; AATTTGAGTTCTGTTCCTTCTGTGT
>probe:Drosophila_2:1635344_at:583:143; Interrogation_Position=1754; Antisense; ACTGCTTGGGTGTCTTGGCCTCAAT
>probe:Drosophila_2:1635344_at:32:329; Interrogation_Position=1786; Antisense; GCGTGCATAAACTCGAAGCCTGCTT

Paste this into a BLAST search page for me
GCGAGAACACTGTGCTTACCGTGATATGGGTGGCCATTGGTTCGACCAGTACCAGTGGTTCGGTGATCGTCCAAGAGCAGATTCTTGACTTAGCCACCAGCTGCAGATACGCGAGGAACCCAAATAATTCAGTCGAGTGCACACGCTGCAAAGTGCATCCCGCAGTACACTGTGGGCGCGTTGAAGCCATTCGGAACTACACTGTCTGTCTGTGGAGCTGCATACGGCATCAACGATGTTATCCTATCCGAAGTGGAAGCCATACCCTTGTCCTAAATTTGAGTTCTGTTCCTTCTGTGTACTGCTTGGGTGTCTTGGCCTCAATGCGTGCATAAACTCGAAGCCTGCTT

Full Affymetrix probeset data:

Annotations for 1635344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720