Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635346_at:

>probe:Drosophila_2:1635346_at:721:157; Interrogation_Position=3521; Antisense; ACACTTTTCAGCAATCGTTCAGATC
>probe:Drosophila_2:1635346_at:420:291; Interrogation_Position=3536; Antisense; CGTTCAGATCGTTGTAATGGCATTT
>probe:Drosophila_2:1635346_at:148:383; Interrogation_Position=3564; Antisense; GAACTATGTTTTCCGATCTTCGTTA
>probe:Drosophila_2:1635346_at:613:197; Interrogation_Position=3636; Antisense; AACGATCCAGTTTAAGCCATCTCAA
>probe:Drosophila_2:1635346_at:290:315; Interrogation_Position=3651; Antisense; GCCATCTCAAGTTTTGCTAATTTTA
>probe:Drosophila_2:1635346_at:509:243; Interrogation_Position=3690; Antisense; AATATTTCTATTGGTGGCATTCACA
>probe:Drosophila_2:1635346_at:71:571; Interrogation_Position=3705; Antisense; GGCATTCACATCCATCGATCGTTGA
>probe:Drosophila_2:1635346_at:75:637; Interrogation_Position=3792; Antisense; TCGACAATTACATTAACATCCTGCC
>probe:Drosophila_2:1635346_at:229:153; Interrogation_Position=3807; Antisense; ACATCCTGCCCATTTGAAAACCATT
>probe:Drosophila_2:1635346_at:639:387; Interrogation_Position=3822; Antisense; GAAAACCATTTATTGACCACCTAGT
>probe:Drosophila_2:1635346_at:563:147; Interrogation_Position=3860; Antisense; ACTATCTTACTTATTTCGTTGTGCA
>probe:Drosophila_2:1635346_at:457:291; Interrogation_Position=3876; Antisense; CGTTGTGCATTCTATTCCAGACTTA
>probe:Drosophila_2:1635346_at:156:281; Interrogation_Position=3915; Antisense; CTCAGATTTCTGTGGACTCAAGCTA
>probe:Drosophila_2:1635346_at:73:521; Interrogation_Position=3926; Antisense; GTGGACTCAAGCTATACACCATAGT

Paste this into a BLAST search page for me
ACACTTTTCAGCAATCGTTCAGATCCGTTCAGATCGTTGTAATGGCATTTGAACTATGTTTTCCGATCTTCGTTAAACGATCCAGTTTAAGCCATCTCAAGCCATCTCAAGTTTTGCTAATTTTAAATATTTCTATTGGTGGCATTCACAGGCATTCACATCCATCGATCGTTGATCGACAATTACATTAACATCCTGCCACATCCTGCCCATTTGAAAACCATTGAAAACCATTTATTGACCACCTAGTACTATCTTACTTATTTCGTTGTGCACGTTGTGCATTCTATTCCAGACTTACTCAGATTTCTGTGGACTCAAGCTAGTGGACTCAAGCTATACACCATAGT

Full Affymetrix probeset data:

Annotations for 1635346_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime