Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635348_at:

>probe:Drosophila_2:1635348_at:695:45; Interrogation_Position=3334; Antisense; ATCCCGAGCAGTGCAAGCTGGACAG
>probe:Drosophila_2:1635348_at:607:691; Interrogation_Position=3375; Antisense; TTTGGCCTGAAGACAGTGCCCACTG
>probe:Drosophila_2:1635348_at:650:669; Interrogation_Position=3406; Antisense; TACCAGAACCCAGAGGCGCGTACAT
>probe:Drosophila_2:1635348_at:187:27; Interrogation_Position=3429; Antisense; ATAGAAGATCGCATTGTCCAGAGAC
>probe:Drosophila_2:1635348_at:351:511; Interrogation_Position=3519; Antisense; GTGAATGGCACCCACAAGGAGCTTA
>probe:Drosophila_2:1635348_at:82:225; Interrogation_Position=3534; Antisense; AAGGAGCTTAAGTCCGCACCACAAG
>probe:Drosophila_2:1635348_at:659:13; Interrogation_Position=3577; Antisense; ATATCGTTTCGAATGGCAACCACTC
>probe:Drosophila_2:1635348_at:413:441; Interrogation_Position=3605; Antisense; GATGGTCAGCACAACCACCAGGATT
>probe:Drosophila_2:1635348_at:676:77; Interrogation_Position=3624; Antisense; AGGATTCAGGAAGTTGCCCACGGCC
>probe:Drosophila_2:1635348_at:101:493; Interrogation_Position=3685; Antisense; GTAAGTCGGATGCTAGTGCCACCAA
>probe:Drosophila_2:1635348_at:669:265; Interrogation_Position=3745; Antisense; CAGATGGCGCCATTGTGACCAGTGG
>probe:Drosophila_2:1635348_at:262:459; Interrogation_Position=3873; Antisense; GATATTAGTACTCCCAATTGCTTGG
>probe:Drosophila_2:1635348_at:512:247; Interrogation_Position=3887; Antisense; CAATTGCTTGGTGTCCGTTTCCGTT
>probe:Drosophila_2:1635348_at:243:719; Interrogation_Position=3905; Antisense; TTCCGTTTCGTGTGTTTATTTGCAG

Paste this into a BLAST search page for me
ATCCCGAGCAGTGCAAGCTGGACAGTTTGGCCTGAAGACAGTGCCCACTGTACCAGAACCCAGAGGCGCGTACATATAGAAGATCGCATTGTCCAGAGACGTGAATGGCACCCACAAGGAGCTTAAAGGAGCTTAAGTCCGCACCACAAGATATCGTTTCGAATGGCAACCACTCGATGGTCAGCACAACCACCAGGATTAGGATTCAGGAAGTTGCCCACGGCCGTAAGTCGGATGCTAGTGCCACCAACAGATGGCGCCATTGTGACCAGTGGGATATTAGTACTCCCAATTGCTTGGCAATTGCTTGGTGTCCGTTTCCGTTTTCCGTTTCGTGTGTTTATTTGCAG

Full Affymetrix probeset data:

Annotations for 1635348_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime