Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635354_at:

>probe:Drosophila_2:1635354_at:155:123; Interrogation_Position=2477; Antisense; ACCACTCTACGGCTATTGCAGTTTA
>probe:Drosophila_2:1635354_at:565:505; Interrogation_Position=2516; Antisense; GTGCACTTTAGTCACCGTAGTTACC
>probe:Drosophila_2:1635354_at:29:645; Interrogation_Position=2564; Antisense; TCTAGTGTAGTATCGCCTCATGCAT
>probe:Drosophila_2:1635354_at:402:701; Interrogation_Position=2594; Antisense; TTTTATGCGCCGTGGCAACCTGAAA
>probe:Drosophila_2:1635354_at:199:31; Interrogation_Position=2627; Antisense; ATAACTTTGCCTCTTCTTGTTGCCT
>probe:Drosophila_2:1635354_at:546:485; Interrogation_Position=2692; Antisense; GTAGAATTTTTCCAACGCCAGTCGG
>probe:Drosophila_2:1635354_at:455:3; Interrogation_Position=2747; Antisense; ATTGGAATGCCACTTAATCCGCGAC
>probe:Drosophila_2:1635354_at:614:227; Interrogation_Position=2780; Antisense; AATGGCAACACACCCGAGGACTGGC
>probe:Drosophila_2:1635354_at:591:637; Interrogation_Position=2811; Antisense; TCGAGGTCTTGTTCGGTGCTGATCA
>probe:Drosophila_2:1635354_at:632:507; Interrogation_Position=2826; Antisense; GTGCTGATCAGGACCCGAAAACGAT
>probe:Drosophila_2:1635354_at:197:547; Interrogation_Position=2859; Antisense; GGATGACCACAATGTCACCTTTGCC
>probe:Drosophila_2:1635354_at:674:313; Interrogation_Position=2891; Antisense; GCCATTCCATTTTGCCAGGTGAGTA
>probe:Drosophila_2:1635354_at:458:307; Interrogation_Position=2905; Antisense; CCAGGTGAGTAGTTTTTGTCGCTTA
>probe:Drosophila_2:1635354_at:609:183; Interrogation_Position=2941; Antisense; AAAATCGTGCGCCAAATTGCCATAA

Paste this into a BLAST search page for me
ACCACTCTACGGCTATTGCAGTTTAGTGCACTTTAGTCACCGTAGTTACCTCTAGTGTAGTATCGCCTCATGCATTTTTATGCGCCGTGGCAACCTGAAAATAACTTTGCCTCTTCTTGTTGCCTGTAGAATTTTTCCAACGCCAGTCGGATTGGAATGCCACTTAATCCGCGACAATGGCAACACACCCGAGGACTGGCTCGAGGTCTTGTTCGGTGCTGATCAGTGCTGATCAGGACCCGAAAACGATGGATGACCACAATGTCACCTTTGCCGCCATTCCATTTTGCCAGGTGAGTACCAGGTGAGTAGTTTTTGTCGCTTAAAAATCGTGCGCCAAATTGCCATAA

Full Affymetrix probeset data:

Annotations for 1635354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime