FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635356_at:

>probe:Drosophila_2:1635356_at:560:415; Interrogation_Position=166; Antisense; GAGCCAGATGTCAAGCCCAACATAC
>probe:Drosophila_2:1635356_at:120:705; Interrogation_Position=226; Antisense; TTATGCGAACGTATAGCCTCCGAAC
>probe:Drosophila_2:1635356_at:404:217; Interrogation_Position=253; Antisense; AAGTTTGAGTGGCTGGACTGCTCCA
>probe:Drosophila_2:1635356_at:629:585; Interrogation_Position=266; Antisense; TGGACTGCTCCAAAATCGCCAAGGA
>probe:Drosophila_2:1635356_at:18:551; Interrogation_Position=318; Antisense; GGAGTACGATTGTCCCATTCTGGAT
>probe:Drosophila_2:1635356_at:564:607; Interrogation_Position=353; Antisense; TGATGGATCACTTGGAGCCCCTGAT
>probe:Drosophila_2:1635356_at:63:255; Interrogation_Position=390; Antisense; CAACGTCGTCGAGTATCATGGCTGT
>probe:Drosophila_2:1635356_at:352:67; Interrogation_Position=407; Antisense; ATGGCTGTGATTTCTTTCCAGAGCG
>probe:Drosophila_2:1635356_at:183:589; Interrogation_Position=433; Antisense; TGGTTTCAAGCCGTCTTCGTGGTAA
>probe:Drosophila_2:1635356_at:588:715; Interrogation_Position=448; Antisense; TTCGTGGTAACCTGTCCCAATACAA
>probe:Drosophila_2:1635356_at:633:671; Interrogation_Position=478; Antisense; TACGATCGTCTGAAGGAGCGCAACT
>probe:Drosophila_2:1635356_at:636:265; Interrogation_Position=532; Antisense; CAGTGCGAGATCTTTGGAACCATTT
>probe:Drosophila_2:1635356_at:428:201; Interrogation_Position=549; Antisense; AACCATTTTGGAAGAGGCCCGCGAT
>probe:Drosophila_2:1635356_at:416:321; Interrogation_Position=565; Antisense; GCCCGCGATTCCTACAAATCAGATA

Paste this into a BLAST search page for me
GAGCCAGATGTCAAGCCCAACATACTTATGCGAACGTATAGCCTCCGAACAAGTTTGAGTGGCTGGACTGCTCCATGGACTGCTCCAAAATCGCCAAGGAGGAGTACGATTGTCCCATTCTGGATTGATGGATCACTTGGAGCCCCTGATCAACGTCGTCGAGTATCATGGCTGTATGGCTGTGATTTCTTTCCAGAGCGTGGTTTCAAGCCGTCTTCGTGGTAATTCGTGGTAACCTGTCCCAATACAATACGATCGTCTGAAGGAGCGCAACTCAGTGCGAGATCTTTGGAACCATTTAACCATTTTGGAAGAGGCCCGCGATGCCCGCGATTCCTACAAATCAGATA

Full Affymetrix probeset data:

Annotations for 1635356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720