FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635358_at:

>probe:Drosophila_2:1635358_at:477:9; Interrogation_Position=1407; Antisense; ATTCTGTGGCATGCAGTGTCGCGAT
>probe:Drosophila_2:1635358_at:423:515; Interrogation_Position=1422; Antisense; GTGTCGCGATGCTCACAAGATGGCC
>probe:Drosophila_2:1635358_at:44:99; Interrogation_Position=1439; Antisense; AGATGGCCCGTCATCGTAAGGAGAT
>probe:Drosophila_2:1635358_at:48:427; Interrogation_Position=1459; Antisense; GAGATGCATCTGAGCCAGGGCACAT
>probe:Drosophila_2:1635358_at:654:149; Interrogation_Position=1480; Antisense; ACATACGTGTGCCATTTGTGCCAGG
>probe:Drosophila_2:1635358_at:321:77; Interrogation_Position=1505; Antisense; AGGAGTTCACCGACATCAGCTACTT
>probe:Drosophila_2:1635358_at:179:207; Interrogation_Position=1540; Antisense; AAGCGTTCGATTCAGTGCCGTAGCA
>probe:Drosophila_2:1635358_at:97:29; Interrogation_Position=1565; Antisense; ATACGCGTCGCTTTGTGAATGCGGA
>probe:Drosophila_2:1635358_at:92:235; Interrogation_Position=1616; Antisense; AATCCATTTCCGGTCGCAATATGAA
>probe:Drosophila_2:1635358_at:484:227; Interrogation_Position=1639; Antisense; AATGGCCAGGACGACGATTACGACG
>probe:Drosophila_2:1635358_at:407:99; Interrogation_Position=1728; Antisense; AGAGGAGCAGGGTTCGCCGTCCAAT
>probe:Drosophila_2:1635358_at:343:545; Interrogation_Position=1881; Antisense; GGATCAGTACTTTAACGCTGTCCAA
>probe:Drosophila_2:1635358_at:420:35; Interrogation_Position=1922; Antisense; ATCAGCAGCATCATGGCCGAGGGCA
>probe:Drosophila_2:1635358_at:639:433; Interrogation_Position=1940; Antisense; GAGGGCAGGACTACAACGACGAGCT

Paste this into a BLAST search page for me
ATTCTGTGGCATGCAGTGTCGCGATGTGTCGCGATGCTCACAAGATGGCCAGATGGCCCGTCATCGTAAGGAGATGAGATGCATCTGAGCCAGGGCACATACATACGTGTGCCATTTGTGCCAGGAGGAGTTCACCGACATCAGCTACTTAAGCGTTCGATTCAGTGCCGTAGCAATACGCGTCGCTTTGTGAATGCGGAAATCCATTTCCGGTCGCAATATGAAAATGGCCAGGACGACGATTACGACGAGAGGAGCAGGGTTCGCCGTCCAATGGATCAGTACTTTAACGCTGTCCAAATCAGCAGCATCATGGCCGAGGGCAGAGGGCAGGACTACAACGACGAGCT

Full Affymetrix probeset data:

Annotations for 1635358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720