FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635360_at:

>probe:Drosophila_2:1635360_at:625:17; Interrogation_Position=2062; Antisense; ATTTATGGATCGAAGCGCTTGGGCG
>probe:Drosophila_2:1635360_at:725:297; Interrogation_Position=2077; Antisense; CGCTTGGGCGGAAATCTGAATGGAA
>probe:Drosophila_2:1635360_at:315:559; Interrogation_Position=2098; Antisense; GGAAATGCCGATGCGCAACATTGAA
>probe:Drosophila_2:1635360_at:478:237; Interrogation_Position=2176; Antisense; AATCGTGTGTAAAGAGGCTAGCAGC
>probe:Drosophila_2:1635360_at:594:571; Interrogation_Position=2191; Antisense; GGCTAGCAGCATACAAACATACATA
>probe:Drosophila_2:1635360_at:66:515; Interrogation_Position=2237; Antisense; GTGTGCATTGAAAACTATTAGGCCC
>probe:Drosophila_2:1635360_at:287:687; Interrogation_Position=2252; Antisense; TATTAGGCCCCTTTACGAGTATATA
>probe:Drosophila_2:1635360_at:379:685; Interrogation_Position=2271; Antisense; TATATACTGACCCTGACTCGATGTG
>probe:Drosophila_2:1635360_at:603:145; Interrogation_Position=2286; Antisense; ACTCGATGTGAGTTGACGGCTCTTA
>probe:Drosophila_2:1635360_at:60:469; Interrogation_Position=2297; Antisense; GTTGACGGCTCTTACACAGATAATA
>probe:Drosophila_2:1635360_at:492:493; Interrogation_Position=2418; Antisense; GTAATTGAATCCAGATTGAGCGGCA
>probe:Drosophila_2:1635360_at:316:5; Interrogation_Position=2432; Antisense; ATTGAGCGGCAATGGCAAGGCGACC
>probe:Drosophila_2:1635360_at:709:225; Interrogation_Position=2448; Antisense; AAGGCGACCGATATGTATTGTATTA
>probe:Drosophila_2:1635360_at:594:673; Interrogation_Position=2557; Antisense; TAGCCAATCAATGTGCGACTAAGCA

Paste this into a BLAST search page for me
ATTTATGGATCGAAGCGCTTGGGCGCGCTTGGGCGGAAATCTGAATGGAAGGAAATGCCGATGCGCAACATTGAAAATCGTGTGTAAAGAGGCTAGCAGCGGCTAGCAGCATACAAACATACATAGTGTGCATTGAAAACTATTAGGCCCTATTAGGCCCCTTTACGAGTATATATATATACTGACCCTGACTCGATGTGACTCGATGTGAGTTGACGGCTCTTAGTTGACGGCTCTTACACAGATAATAGTAATTGAATCCAGATTGAGCGGCAATTGAGCGGCAATGGCAAGGCGACCAAGGCGACCGATATGTATTGTATTATAGCCAATCAATGTGCGACTAAGCA

Full Affymetrix probeset data:

Annotations for 1635360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720