FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635361_at:

>probe:Drosophila_2:1635361_at:508:695; Interrogation_Position=107; Antisense; TTCTCAGGGAGCTTAAGGACTTCGT
>probe:Drosophila_2:1635361_at:507:623; Interrogation_Position=120; Antisense; TAAGGACTTCGTCGCGGCCTTGGAC
>probe:Drosophila_2:1635361_at:359:155; Interrogation_Position=143; Antisense; ACACCCTGGACTTCGATGATTCATT
>probe:Drosophila_2:1635361_at:545:345; Interrogation_Position=209; Antisense; GCATCATTTCGATTGCAGGCAGCAA
>probe:Drosophila_2:1635361_at:375:103; Interrogation_Position=21; Antisense; AGACGCCATGGAACAGCTACGACAT
>probe:Drosophila_2:1635361_at:656:435; Interrogation_Position=256; Antisense; GAGGTTGTCGTTCAGCTATTCATAC
>probe:Drosophila_2:1635361_at:240:645; Interrogation_Position=275; Antisense; TCATACAGCACGGAGTTGAGGACCT
>probe:Drosophila_2:1635361_at:406:607; Interrogation_Position=291; Antisense; TGAGGACCTGGAGCAGATCCTGGAA
>probe:Drosophila_2:1635361_at:41:503; Interrogation_Position=378; Antisense; GTCCGACAGTCGGTTGGCCAGGAAC
>probe:Drosophila_2:1635361_at:413:135; Interrogation_Position=401; Antisense; ACGCGGCGATGGTCAAGCAGTTTAA
>probe:Drosophila_2:1635361_at:518:401; Interrogation_Position=41; Antisense; GACATGTCTTTCAATTGGTCATCGA
>probe:Drosophila_2:1635361_at:396:37; Interrogation_Position=61; Antisense; ATCGACGAGGCCGAACTCATTTTAC
>probe:Drosophila_2:1635361_at:629:643; Interrogation_Position=77; Antisense; TCATTTTACCACCAAACTCCAAGGG
>probe:Drosophila_2:1635361_at:133:193; Interrogation_Position=91; Antisense; AACTCCAAGGGACACATTCTCAGGG

Paste this into a BLAST search page for me
TTCTCAGGGAGCTTAAGGACTTCGTTAAGGACTTCGTCGCGGCCTTGGACACACCCTGGACTTCGATGATTCATTGCATCATTTCGATTGCAGGCAGCAAAGACGCCATGGAACAGCTACGACATGAGGTTGTCGTTCAGCTATTCATACTCATACAGCACGGAGTTGAGGACCTTGAGGACCTGGAGCAGATCCTGGAAGTCCGACAGTCGGTTGGCCAGGAACACGCGGCGATGGTCAAGCAGTTTAAGACATGTCTTTCAATTGGTCATCGAATCGACGAGGCCGAACTCATTTTACTCATTTTACCACCAAACTCCAAGGGAACTCCAAGGGACACATTCTCAGGG

Full Affymetrix probeset data:

Annotations for 1635361_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720