FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635362_at:

>probe:Drosophila_2:1635362_at:437:69; Interrogation_Position=2374; Antisense; AGGCGCTACTACACCGAGGGCGTAA
>probe:Drosophila_2:1635362_at:96:329; Interrogation_Position=2393; Antisense; GCGTAATCTACTTCTTTGCCATGTT
>probe:Drosophila_2:1635362_at:94:59; Interrogation_Position=2413; Antisense; ATGTTCTTCTCGATCTTCTATCACG
>probe:Drosophila_2:1635362_at:664:57; Interrogation_Position=2456; Antisense; ATGAGTACAGCTTCTGCCTGGTGAA
>probe:Drosophila_2:1635362_at:319:517; Interrogation_Position=2486; Antisense; GTGTGCTACAGTTCTGCGACTTCTA
>probe:Drosophila_2:1635362_at:404:721; Interrogation_Position=2518; Antisense; TTGCTGAGCATCTGGGTGACCCTGG
>probe:Drosophila_2:1635362_at:293:291; Interrogation_Position=2571; Antisense; CGTCTCACTACTGCACATGTTTGGA
>probe:Drosophila_2:1635362_at:529:287; Interrogation_Position=2605; Antisense; CTGGCCTTTGGTACGGAGCTGAATA
>probe:Drosophila_2:1635362_at:624:115; Interrogation_Position=2635; Antisense; AGCTTATGGGTGTTCTTGGCTCCAG
>probe:Drosophila_2:1635362_at:86:63; Interrogation_Position=2703; Antisense; ATGTGCCAAGTCTCGTAAGCTGTTC
>probe:Drosophila_2:1635362_at:26:97; Interrogation_Position=2737; Antisense; AGATACCTATCGGTGTGGCTGCCCT
>probe:Drosophila_2:1635362_at:47:509; Interrogation_Position=2793; Antisense; GTGCTATGCCTTTCTGCAGACTAAG
>probe:Drosophila_2:1635362_at:187:541; Interrogation_Position=2853; Antisense; GGTTATGGCGTTGAGCATCCTATGC
>probe:Drosophila_2:1635362_at:608:391; Interrogation_Position=2891; Antisense; GAAAGTCCTTCCTGCCGAAGTGCTA

Paste this into a BLAST search page for me
AGGCGCTACTACACCGAGGGCGTAAGCGTAATCTACTTCTTTGCCATGTTATGTTCTTCTCGATCTTCTATCACGATGAGTACAGCTTCTGCCTGGTGAAGTGTGCTACAGTTCTGCGACTTCTATTGCTGAGCATCTGGGTGACCCTGGCGTCTCACTACTGCACATGTTTGGACTGGCCTTTGGTACGGAGCTGAATAAGCTTATGGGTGTTCTTGGCTCCAGATGTGCCAAGTCTCGTAAGCTGTTCAGATACCTATCGGTGTGGCTGCCCTGTGCTATGCCTTTCTGCAGACTAAGGGTTATGGCGTTGAGCATCCTATGCGAAAGTCCTTCCTGCCGAAGTGCTA

Full Affymetrix probeset data:

Annotations for 1635362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720