Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635363_a_at:

>probe:Drosophila_2:1635363_a_at:590:633; Interrogation_Position=1009; Antisense; TCTGCAGATGCAATAGTACGATACG
>probe:Drosophila_2:1635363_a_at:87:489; Interrogation_Position=1024; Antisense; GTACGATACGCTTCCCAGATGAGAA
>probe:Drosophila_2:1635363_a_at:680:355; Interrogation_Position=639; Antisense; GCAACCCCGTCACAGGCGAGGGCTA
>probe:Drosophila_2:1635363_a_at:557:533; Interrogation_Position=667; Antisense; GGTCGTAGCCAACGAGTATTCCCAG
>probe:Drosophila_2:1635363_a_at:292:309; Interrogation_Position=694; Antisense; CCAGGAGTCGTCCAATGGCGGCACT
>probe:Drosophila_2:1635363_a_at:581:145; Interrogation_Position=756; Antisense; ACTCGTCGGGCCTGTGGTAATGACA
>probe:Drosophila_2:1635363_a_at:122:657; Interrogation_Position=773; Antisense; TAATGACAGCCGGAATTGCTCAGAT
>probe:Drosophila_2:1635363_a_at:370:565; Interrogation_Position=784; Antisense; GGAATTGCTCAGATCCCAGCACAAG
>probe:Drosophila_2:1635363_a_at:96:265; Interrogation_Position=800; Antisense; CAGCACAAGCAATTGAGGAGCCGAT
>probe:Drosophila_2:1635363_a_at:609:125; Interrogation_Position=818; Antisense; AGCCGATGGCGGGACGAGACACTAT
>probe:Drosophila_2:1635363_a_at:451:29; Interrogation_Position=882; Antisense; ATACTACCCATCTAATATACGCATA
>probe:Drosophila_2:1635363_a_at:387:21; Interrogation_Position=896; Antisense; ATATACGCATAAAACCCTACACTCC
>probe:Drosophila_2:1635363_a_at:548:663; Interrogation_Position=913; Antisense; TACACTCCCGTATCCAGGTCAGAAA
>probe:Drosophila_2:1635363_a_at:274:485; Interrogation_Position=954; Antisense; GTAGGACATGATGGCCAACGAATAA

Paste this into a BLAST search page for me
TCTGCAGATGCAATAGTACGATACGGTACGATACGCTTCCCAGATGAGAAGCAACCCCGTCACAGGCGAGGGCTAGGTCGTAGCCAACGAGTATTCCCAGCCAGGAGTCGTCCAATGGCGGCACTACTCGTCGGGCCTGTGGTAATGACATAATGACAGCCGGAATTGCTCAGATGGAATTGCTCAGATCCCAGCACAAGCAGCACAAGCAATTGAGGAGCCGATAGCCGATGGCGGGACGAGACACTATATACTACCCATCTAATATACGCATAATATACGCATAAAACCCTACACTCCTACACTCCCGTATCCAGGTCAGAAAGTAGGACATGATGGCCAACGAATAA

Full Affymetrix probeset data:

Annotations for 1635363_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime