FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635364_at:

>probe:Drosophila_2:1635364_at:689:183; Interrogation_Position=1027; Antisense; AACAATCCGATTGCATGCCATCCAT
>probe:Drosophila_2:1635364_at:456:347; Interrogation_Position=1039; Antisense; GCATGCCATCCATCAACGGAATTTC
>probe:Drosophila_2:1635364_at:68:243; Interrogation_Position=1058; Antisense; AATTTCCAAATTCTATCCCGTCGAG
>probe:Drosophila_2:1635364_at:467:163; Interrogation_Position=1065; Antisense; AAATTCTATCCCGTCGAGCGGTTAT
>probe:Drosophila_2:1635364_at:420:119; Interrogation_Position=1081; Antisense; AGCGGTTATTTGTTTTCTGATCCTC
>probe:Drosophila_2:1635364_at:427:477; Interrogation_Position=1092; Antisense; GTTTTCTGATCCTCATATCTGGTTT
>probe:Drosophila_2:1635364_at:31:541; Interrogation_Position=1112; Antisense; GGTTTAAAGCACACCGCGCATGCAA
>probe:Drosophila_2:1635364_at:299:479; Interrogation_Position=1145; Antisense; GTTTACAATCATCGATCTAGCGTCG
>probe:Drosophila_2:1635364_at:442:509; Interrogation_Position=757; Antisense; GTGCACCAATCCGACTTTACAGATT
>probe:Drosophila_2:1635364_at:622:663; Interrogation_Position=788; Antisense; TAAATCGATGATTATAGCCGCAAGT
>probe:Drosophila_2:1635364_at:442:125; Interrogation_Position=803; Antisense; AGCCGCAAGTTGTGAGCATAATCAT
>probe:Drosophila_2:1635364_at:218:375; Interrogation_Position=844; Antisense; GAAGATCTGCATTGTTTATACTCGT
>probe:Drosophila_2:1635364_at:343:687; Interrogation_Position=860; Antisense; TATACTCGTTTCGATTCGCATGAGG
>probe:Drosophila_2:1635364_at:513:457; Interrogation_Position=937; Antisense; GATAGCTTAGACTACGTTTCAATAA

Paste this into a BLAST search page for me
AACAATCCGATTGCATGCCATCCATGCATGCCATCCATCAACGGAATTTCAATTTCCAAATTCTATCCCGTCGAGAAATTCTATCCCGTCGAGCGGTTATAGCGGTTATTTGTTTTCTGATCCTCGTTTTCTGATCCTCATATCTGGTTTGGTTTAAAGCACACCGCGCATGCAAGTTTACAATCATCGATCTAGCGTCGGTGCACCAATCCGACTTTACAGATTTAAATCGATGATTATAGCCGCAAGTAGCCGCAAGTTGTGAGCATAATCATGAAGATCTGCATTGTTTATACTCGTTATACTCGTTTCGATTCGCATGAGGGATAGCTTAGACTACGTTTCAATAA

Full Affymetrix probeset data:

Annotations for 1635364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720