FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635365_at:

>probe:Drosophila_2:1635365_at:430:209; Interrogation_Position=1034; Antisense; AAGCAACCGCATAGATTTCGATTTG
>probe:Drosophila_2:1635365_at:102:709; Interrogation_Position=1050; Antisense; TTCGATTTGTACTTGTAGGCCTTAG
>probe:Drosophila_2:1635365_at:402:527; Interrogation_Position=1096; Antisense; GGGTTTTAACATGTTTTCTGCAAAT
>probe:Drosophila_2:1635365_at:217:387; Interrogation_Position=617; Antisense; GAAAAAGGCCGGCATCGTTGACCCA
>probe:Drosophila_2:1635365_at:690:95; Interrogation_Position=682; Antisense; AGATTCTCTCGAAGACGGGCAATAT
>probe:Drosophila_2:1635365_at:259:457; Interrogation_Position=720; Antisense; GATACGTACGAAAGCATCAAGGCCA
>probe:Drosophila_2:1635365_at:46:253; Interrogation_Position=743; Antisense; CAAGATCGCCGATTTGCCAGGAACG
>probe:Drosophila_2:1635365_at:674:3; Interrogation_Position=827; Antisense; ATTGGAGCGCTCTAAGACATCGTCG
>probe:Drosophila_2:1635365_at:356:401; Interrogation_Position=842; Antisense; GACATCGTCGAGTGATAGCTCCAAA
>probe:Drosophila_2:1635365_at:426:513; Interrogation_Position=853; Antisense; GTGATAGCTCCAAACCAACGACGAC
>probe:Drosophila_2:1635365_at:221:311; Interrogation_Position=867; Antisense; CCAACGACGACTACCTCAGAGGTGA
>probe:Drosophila_2:1635365_at:595:423; Interrogation_Position=918; Antisense; GAGACTGATATCCAGGGACCCTTTT
>probe:Drosophila_2:1635365_at:65:445; Interrogation_Position=958; Antisense; TGAAATGGTCCCAGGAGAACTACTT
>probe:Drosophila_2:1635365_at:54:89; Interrogation_Position=992; Antisense; AGTCTATGTGCGAAAGTGCGGCGAA

Paste this into a BLAST search page for me
AAGCAACCGCATAGATTTCGATTTGTTCGATTTGTACTTGTAGGCCTTAGGGGTTTTAACATGTTTTCTGCAAATGAAAAAGGCCGGCATCGTTGACCCAAGATTCTCTCGAAGACGGGCAATATGATACGTACGAAAGCATCAAGGCCACAAGATCGCCGATTTGCCAGGAACGATTGGAGCGCTCTAAGACATCGTCGGACATCGTCGAGTGATAGCTCCAAAGTGATAGCTCCAAACCAACGACGACCCAACGACGACTACCTCAGAGGTGAGAGACTGATATCCAGGGACCCTTTTTGAAATGGTCCCAGGAGAACTACTTAGTCTATGTGCGAAAGTGCGGCGAA

Full Affymetrix probeset data:

Annotations for 1635365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720