FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635366_at:

>probe:Drosophila_2:1635366_at:47:471; Interrogation_Position=1013; Antisense; GTTCCGACTCTGATGATAAGCCTTC
>probe:Drosophila_2:1635366_at:370:455; Interrogation_Position=1027; Antisense; GATAAGCCTTCGATCAGTGGAATAA
>probe:Drosophila_2:1635366_at:91:73; Interrogation_Position=1067; Antisense; AGGACTATTGGAATTCCCCGCGAGG
>probe:Drosophila_2:1635366_at:524:363; Interrogation_Position=1077; Antisense; GAATTCCCCGCGAGGAGTGCAACTA
>probe:Drosophila_2:1635366_at:640:697; Interrogation_Position=1161; Antisense; TTTAGACAGCGATTACAGCTCGGAT
>probe:Drosophila_2:1635366_at:587:393; Interrogation_Position=696; Antisense; GAAAGGTCTCACACCCAAGAGCATT
>probe:Drosophila_2:1635366_at:652:213; Interrogation_Position=712; Antisense; AAGAGCATTAGTACTCCACCTCGTT
>probe:Drosophila_2:1635366_at:48:97; Interrogation_Position=768; Antisense; AGATAGTTCTGAATCCGATGTCCTG
>probe:Drosophila_2:1635366_at:722:437; Interrogation_Position=784; Antisense; GATGTCCTGGAATCGGATTACAGCG
>probe:Drosophila_2:1635366_at:431:367; Interrogation_Position=814; Antisense; GAATCGGAGGACAGTGACGCATATA
>probe:Drosophila_2:1635366_at:8:409; Interrogation_Position=829; Antisense; GACGCATATAAGGACATACCCGATA
>probe:Drosophila_2:1635366_at:185:685; Interrogation_Position=864; Antisense; TATCGATGACTTGCCGCCAGAGGGA
>probe:Drosophila_2:1635366_at:631:199; Interrogation_Position=950; Antisense; AACGCGACAATATTCCGAGCACATC
>probe:Drosophila_2:1635366_at:337:421; Interrogation_Position=966; Antisense; GAGCACATCGAGGAAGCAACATTTT

Paste this into a BLAST search page for me
GTTCCGACTCTGATGATAAGCCTTCGATAAGCCTTCGATCAGTGGAATAAAGGACTATTGGAATTCCCCGCGAGGGAATTCCCCGCGAGGAGTGCAACTATTTAGACAGCGATTACAGCTCGGATGAAAGGTCTCACACCCAAGAGCATTAAGAGCATTAGTACTCCACCTCGTTAGATAGTTCTGAATCCGATGTCCTGGATGTCCTGGAATCGGATTACAGCGGAATCGGAGGACAGTGACGCATATAGACGCATATAAGGACATACCCGATATATCGATGACTTGCCGCCAGAGGGAAACGCGACAATATTCCGAGCACATCGAGCACATCGAGGAAGCAACATTTT

Full Affymetrix probeset data:

Annotations for 1635366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720